Predominance of G3B and G14 equine group A rotaviruses of a single VP4 serotype in Japan

Tsunemitsu, Hiroshi; Imagawa, Hiroshi; Togo, Masaharu; Shouji, T.; Kawashima, Kenji; Horino, Rieko; Imai, Kunitoshi; Nishimori, Tomoko; Takagi, Michihiro; Higuchi, Tohru

doi:10.1007/s007050170044

Cited by 39 publications

(53 citation statements)

References 44 publications

(107 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For G3 typing, the G3E primer (CAATCGAAGAGATTGCGACAG) was u s e d , a n d f o r G 1 4 t y p i n g , t h e G 1 4 D p r i m e r (GACGAAGCATTGCAATTA) was employed. PCR was conducted by the method described by Tsunemitsu et al [14].…”

Section: Virus Rna Detection In Feces and Vp7 Typing By Pcrmentioning

confidence: 99%

“…The serotypes and genotypes of rotaviruses are classified by differences in the antigenicity of two kinds of viral outer capsid protein (VP4 and VP7) or the VP4 coding gene. It has been confirmed that both the G3P [12] and G14P [12] rotaviruses spread in the Hidaka region of Hokkaido in 1996 and 1997 [14], although the G3P [12] rotavirus emerged between 1981 and 1991 [7,11,13]. It has been suggested that the G3P [12] rotavirus was predominant in surveys conducted on sera collected from yearlings in the same region in 1999, but the G14P [ 1 2 ] r o t a v i r u s h a s a l s o s p r e a d [ 8 ] .…”

mentioning

confidence: 99%

See 1 more Smart Citation

Field Study of Inactivated Equine Rotavirus Vaccine

Imagawa

Kato

Tsunemitsu

et al. 2005

JES

View full text Add to dashboard Cite

show abstract

Section: Virus Rna Detection In Feces and Vp7 Typing By Pcrmentioning

confidence: 99%

mentioning

confidence: 99%

Field Study of Inactivated Equine Rotavirus Vaccine

Imagawa

Kato

Tsunemitsu

et al. 2005

JES

View full text Add to dashboard Cite

show abstract

“…VP7 and VP4 are classified as G (glycoprotein) serotypes by virus neutralization tests and P (protease-sensitive) genotypes by genetic analyses [14], respectively. Only G3 P [12] and G14 P [12] strains are currently considered to be circulating in the horse populations of Japan, Australia, Germany, Ireland and the United Kingdom [2,4,7,13,16]. Equine rotavirus infection has been diagnosed by electron microscopy, virus isolation, serological tests and molecular diagnostic methods [1,5].…”

mentioning

confidence: 99%

“…HO-5 (G3 P [12]) [12] and JE77 (G14 P [12]) [16] strains of equine rotavirus were used to evaluate the performance of the kits. The JE77 strain was kindly provided by Dr. H. Tsunemitsu, National Institute of Animal Health, Ibaraki, Japan.…”

mentioning

confidence: 99%

Evaluation of Rapid Antigen Detection Kits for Diagnosis of Equine Rotavirus Infection

Nemoto

Hata

Higuchi

et al. 2010

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

ABSTRACT. We evaluated antigen detection kits for human rotavirus with regard to their usefulness for diagnosing equine rotavirus infection. Limiting dilution analyses showed that of the seven kits investigated the Dipstick 'Eiken' Rota (Dipstick) had the highest sensitivity to two serotypes of equine rotavirus. The Dipstick did not cross-react with several equine intestinal pathogens. An investigation using 249 fecal samples indicated that the sensitivity of the Dipstick was 81.9% and 47.3%, and its specificity was 98.2% and 99.0%, and its concordance rate was 92.8% and 68.3%, compared with values obtained using reverse transcription polymerase chain reaction and reverse transcription loop-mediated isothermal amplification, respectively. Although a negative result does not preclude the possibility of equine rotavirus infection, the Dipstick would be useful as routine test for diagnosing equine rotavirus infection in daily clinical practice because of its ease of handling.KEY WORDS: diagnosis, equine rotavirus, rapid antigen detection.J. Vet. Med. Sci. 72(9): 1247-1250, 2010 Equine rotavirus is a non-enveloped virus belonging to the genus Rotavirus in the family Reoviridae. Equine rotavirus infection is a major cause of diarrhea in foals up to 3 months of age [3,10]. Equine rotavirus has two outer capsid proteins, VP7 and VP4, which are independent neutralization antigens. VP7 and VP4 are classified as G (glycoprotein) serotypes by virus neutralization tests and P (protease-sensitive) genotypes by genetic analyses [14], respectively. Only G3 P[12] and G14 P[12] strains are currently considered to be circulating in the horse populations of Japan, Australia, Germany, Ireland and the United Kingdom [2,4,7,13,16]. Equine rotavirus infection has been diagnosed by electron microscopy, virus isolation, serological tests and molecular diagnostic methods [1,5]. These methods are not routinely available in diagnostic laboratories because they require sophisticated techniques and expensive equipment. It is difficult for clinical veterinarians to conduct these diagnostic methods as part of their daily clinical practice. Therefore, we focused our attention on rapid antigen detection (RAD) kits for use in routine tests in daily clinical practice. RAD kits do not require additional reagents, equipment or expertise, and results can be obtained within 15 min. RAD kits are designed to detect human group A rotaviruses based on the principle of latex agglutination assay (LA) or immunochromatographic assay. Because equine rotavirus is classified as a group A rotavirus, it is anticipated that RAD kits would also work for the rapid diagnosis of equine rotavirus infection. In fact, one LA kit (Virogen Rotatest, Wampole Laboratories, N.J., U.S.A.), which is not commercially available in Japan, has been reported to be useful for diagnosing equine rotavirus infection [6]. Although several RAD kits are available in Japan, their performance as regards the diagnosis of equine rotavirus infection has not been examined. In this study, we have ...

show abstract

“…The virus has two outer capsid proteins, VP7 and VP4, which are independently associated with the serotype specificities for G serotype (for glycoprotein) and the P serotype (for protease-sensitive protein), respectively 1 . In human and animal rotaviruses 27 G 13 and Japon [14][15][16] . Reports reveals that the majority of rotavirus strain from foals are either G3P [12] or G14P [12] 5,7,9, [11][12][13][14]16,17 .…”

Section: Makale Kodu (Article Code): Kvfd-2012-8186mentioning

confidence: 99%

Rotavirus Diarrhea Outbreaks in Arabian Thoroughbred Foals in a Stud Farm, Turkey

Alkan

Timurkan²,

Karayel³

2013

Kafkas Univ Vet Fak Derg

View full text Add to dashboard Cite

SummaryIn this study, the aetiological agent of diarrhea in Arabian thoroughbred foals housed in a stud farms and it's molecular characterization were reported. Out of sampled seven foals with diarrhoea, five were detected positive by RT-PCR depending on the amplification of the VP6 gene of rotavirus. Then the aetiological agent was characterized genetically by sequence analysis of the genome segments encoding VP6, VP7, VP4 and NSP4 of rotavirus. Findings revealed that the Turkish equine rotavirus circulating within this stud farm belongs to G3 and P[12] genotype with E2 NSP4 and I6VP6. This is the first study to report the G and P genotypes of equine group A rotaviruses in Turkey. Keywords: Rotavirus, Equine, Genotyping, Diarrhoea, Turkey Türkiye'de Bir Arap Atı İşletmesindeki Taylarda Rotavirus İshali Salgını ÖzetBu çalışmada, bir at yetiştiriciliği işletmesinde bulunan safkan arap taylarındaki ishal olgusunun etiyolojik ajanının tespiti ve moleküler karakterizasyonu bildirildi. İshal semptomlu yedi taydan sağlanan materyallerin beşinde RT-PCR tekniği ile rotavirus VP6 geni yönünden pozitiflik saptandı. Daha sonra enfeksiyona neden olan virusun VP6, VP7, VP4 ve NSP4 gen bölgelerini kodlayan gen bölgelerinin dizi analizi yapıldı. Elde edilen verilere dayanılarak söz konusu at yetiştiriciliği işletmesinde enfeksiyona neden olan ERV saha suşunun E2 NSP4 ve I6VP6 ile ilişkili G3P[12] genotipinde olduğu belirlendi. Bu çalışma, Türkiye'de atlardaki grup A rotavirusların G ve P genotiplerinin bildirildiği ilk çalışmadır.

show abstract

Predominance of G3B and G14 equine group A rotaviruses of a single VP4 serotype in Japan

Cited by 39 publications

References 44 publications

Field Study of Inactivated Equine Rotavirus Vaccine

Field Study of Inactivated Equine Rotavirus Vaccine

Evaluation of Rapid Antigen Detection Kits for Diagnosis of Equine Rotavirus Infection

Rotavirus Diarrhea Outbreaks in Arabian Thoroughbred Foals in a Stud Farm, Turkey

Contact Info

Product

Resources

About