Precise Mapping of the Brain α2-Adrenergic Receptor Gene within Chromosome 4p16

Rieß, Olaf; Thies, Ulrike; Siedlaczck, I; Potisek, Susanne; Graham, Rona; Theilmann, Jane; Grimm, Tiemo; Epplen, Jörg T.; Hayden, Michael R.

doi:10.1006/geno.1994.1061

Cited by 14 publications

(11 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…DNA from cosmids pC847.351 (D4F26), 18 CD2 (D4S90), 19 33c6 (D4S43), 20 L21f12 (D4S180), L228a7 (D4S81), 21 L247f6 containing the FGFR3 gene, 22 and inter-Alu PCR products 23 from YAC 877G6, 405D10, 794D12, 225D2, 435A11, 400F9, 848G12, and 796D3 (CEPH) were labelled with digoxigenin by using a BRL nick-translation kit (Gibco, Life Technologies, Gaitherburg, MD, USA). Labelled cosmid and YAC DNA was separated from unincorporated nucleotides by using 1800 ml Centricon 30 filters (Amicon, Beverly, MA, USA).…”

Section: Fluorescence In Situ Hybridisation (Fish)mentioning

confidence: 99%

Effect of the size of the deletion and clinical manifestation in Wolf-Hirschhorn syndrome: analysis of 13 patients with a de novo deletion

et al. 2000

Self Cite

View full text Add to dashboard Cite

We performed clinical, cytogenetic, and molecular analyses on 13 patients (8 females and 5 males, aged 6 months to 13 years) with Wolf-Hirschhorn syndrome due to de novo deletions of chromosome 4p. All patients presented with the typical facial gestalt, microcephaly, and profound mental retardation. Other clinical signs were low birth weight (10/13; 77%), postnatal short stature (8/12; 66%), muscular hypotonia (12/13; 92%), seizures (11/13; 85%), congenital heart defects (4/13; 31%), colobomata of iris (4/12; 33%), genital anomalies (4/13; 31%), deafness (3/13; 23%), and renal anomalies (3/13; 23%). The smallest deletion was a submicroscopic terminal deletion of nearly 2.5 Mb. The largest was a terminal deletion of nearly 30 Mb. Cleft lip/palate, preauricular pits/tags, and congenital heart defects were present only in patients with terminal deletions larger than 10 Mb. The deviations from mean birth weight, birth length, and postnatal head circumference correlated with the size of the deletion. Determining the parental origin of the deletion with microsatellite markers, the maternal allele was missing in three patients and the paternal allele in eight patients. Our observations support the existence of a partial genotype-phenotype correlation in Wolf-Hirschhorn syndrome.

show abstract

Section: Fluorescence In Situ Hybridisation (Fish)mentioning

confidence: 99%

Effect of the size of the deletion and clinical manifestation in Wolf-Hirschhorn syndrome: analysis of 13 patients with a de novo deletion

et al. 2000

Self Cite

View full text Add to dashboard Cite

show abstract

“…Genotyping of chromosome 4p was performed using the following previously described microsatellite markers: D4S1182 (Acc ID GDB 19723924), D4S43 (Acc ID GDB 12436024), ADRA2C (Acc ID GDB 37083425), HOX7 (Acc ID GDB 15699126 27), D4S403 (Acc ID GDB 18810628), D4S2366 (Acc ID GDB 684453), D4S2639 (Acc ID GDB 685881), and D4S2397 (Acc ID GDB 683982). A new microsatellite, 75B9Rep, was generated by one of the authors based on sequence information of cosmid 75B9A (Acc No Z69651) which is derived from the distal end of the Huntington's disease cosmid contig 29.…”

mentioning

confidence: 99%

“…The Hu4/Hu5 (Acc ID GDB 249651) primer pair amplifies the CAG repeat of the huntingtin gene. Primer Hu4 has been published by Riess et al 25 (primer sequence: Hu4 5′ ATGGCGACCCTGGAAAAGCTGATGAA 3′), and primer Hu5 has been published by Rubinsztein et al 30 (primer sequence: Hu5 5′ GGCGGTGGCGGCTGTTGCTGCTGCTGC 3′).…”

mentioning

confidence: 99%

Unexpected high frequency of de novo unbalanced translocations in patients with Wolf-Hirschhorn syndrome (WHS)

Wieczorek¹,

Krause²,

Majewski³

et al. 2000

Journal of Medical Genetics

View full text Add to dashboard Cite

“…The gene for the ␣2C subtype has been localized to chromosome 4p16, close to the gene responsible for Huntingtons disease, 10 and two polymorphic dinucleotide repeats have been localized in close proximity to the ADRA2C gene. 10 For this linkage study, we used the (GT) n repeat (marker adra2c1) that was localized closest to the ADRA2C gene as a genetic marker for the gene. Researchers have used this polymorphism to investigate this gene as a susceptibility factor in ADHD, employing a quantitative approach and ADHD symptom scores in 274 individuals diagnosed with Tourette syndrome and 62 controls.…”

mentioning

confidence: 99%

“…3 These receptors have been divided into three subtypes; ␣2A, ␣2B, and ␣2C. The gene for the ␣2C subtype has been localized to chromosome 4p16, close to the gene responsible for Huntingtons disease, 10 and two polymorphic dinucleotide repeats have been localized in close proximity to the ADRA2C gene. 10 For this linkage study, we used the (GT) n repeat (marker adra2c1) that was localized closest to the ADRA2C gene as a genetic marker for the gene.…”

mentioning

confidence: 99%

Attention-deficit hyperactivity disorder and the adrenergic receptors α1C and α2C

et al. 2001

View full text Add to dashboard Cite

Keywords: attention-deficit hyperactivity disorder; adrenergic receptor ␣1C; adrenergic receptor ␣2C; linkage; norepinephrineThe adrenergic system has been hypothesized to be involved in the etiology of attention-deficit hyperactivity disorder (ADHD) based on pharmacological interventions and animal models. Noradrenergic neurons are implicated in the modulation of vigilance, improvement of visual attention, initiation of adaptive response, learning and memory. In this study we tested the genes for two adrenergic receptors, ␣1C (ADRA1C) located on chromosome 8p11.2, and ␣2C (ADRA2C) located on chromosome 4p16, as genetic susceptibility factors in ADHD. For the adrenergic receptor ␣1C we used a C to T polymorphism that results in a change of Cys to Arg at codon 492 for the linkage study. For the adrenergic receptor ␣2C gene we examined a dinucleotide repeat polymorphism located approximately 6 kb from the gene. We examined these polymorphisms in a sample of 103 families ascertained through an ADHD proband. Using the transmission disequilibrium test, we did not observe biased transmission of any of the alleles of these polymorphisms. We conclude that the alleles at the polymorphisms tested in these two genes are not linked to the ADHD phenotype in this sample of families. Molecular Psychiatry (2001) 6, 334-337. While the recent investigation of the molecular genetics of ADHD has focused on the dopaminergic system, an extensive body of literature has implicated the involvement of the adrenergic system in ADHD. 1,2 The notion that the adrenergic system is involved in ADHD derives from several lines of research including the manipulation of the catecholamine system in animals and the pharmacological response to adrenergic agonists in humans. In rodents, norepinephrine depletion results in increased distractibility and motor hyperactivity and in non-human primates, stimulation of the noradrenergic system has been shown to improve cognitive function and distractibility. 3 The improvement in ADHD symptoms with tricyclic antidepressants has been attributed to the actions of these drugs in the reuptake of norepinephrine. 1 Noradrenergic receptors are divided into three major categories: alpha1, alpha2, and beta. Activation of alpha 1 receptors in rats promotes vigilance (sustained attention), decreases impulsivity, and influences working memory and behavioral activation while having only a minor role in the modulation of long-term memory. 4 The alpha adrenergic receptors have been classified as ␣1A, ␣1B, and ␣1D corresponding to their ligand binding properties. Four ␣ adrenoreceptors, ␣1a, ␣1b, ␣1c, and ␣1d, have been cloned 5 and the cloned ␣1c receptor 6 has been identified as the receptor corresponding to the alpha 1 A-ligand binding site. 5 The gene for the ␣1C receptor has been localized by somatic cell hybridization 7 and by multi-point linkage analysis to 8p11.2. 8 Thus far only a single polymorphism has been identified for this gene, a C to T change located in codon 492 resulting in a change of cysteine to argin...

show abstract

Precise Mapping of the Brain α2-Adrenergic Receptor Gene within Chromosome 4p16

Cited by 14 publications

References 0 publications

Effect of the size of the deletion and clinical manifestation in Wolf-Hirschhorn syndrome: analysis of 13 patients with a de novo deletion

Effect of the size of the deletion and clinical manifestation in Wolf-Hirschhorn syndrome: analysis of 13 patients with a de novo deletion

Unexpected high frequency of de novo unbalanced translocations in patients with Wolf-Hirschhorn syndrome (WHS)

Attention-deficit hyperactivity disorder and the adrenergic receptors α1C and α2C

Contact Info

Product

Resources

About