Post-Transcriptional Regulation of the Expression of Ferrochelatase by Its Variant mRNA

Sakaino, Masayoshi; Kataoka, Takao; Taketani, Shigeru

doi:10.1093/jb/mvp030

Cited by 3 publications

(5 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…First, such a reduction may indicate the saturation of PpIX biosynthesis enzyme activity. Silencing FECH inhibits the conversion of PpIX to heme, which causes the accumulation of porphyrin metabolites (particularly its substrate PpIX) in heme biosynthesis pathway and activates heme biosynthesis due to the release of negative feedback inhibition on heme biosynthesis pathway . Imposing on this already activated PpIX biosynthesis pathway with additional load of exogenous ALA may saturate pathway activity, thereby failing to obtain more ALA‐stimulated PpIX production.…”

Section: Discussionmentioning

confidence: 99%

Effects of Silencing Heme Biosynthesis Enzymes on 5‐Aminolevulinic Acid‐mediated Protoporphyrin IX Fluorescence and Photodynamic Therapy

Yang

Palasuberniam

et al. 2015

Photochem & Photobiology

View full text Add to dashboard Cite

Aminolevulinic acid (ALA)-mediated protoporphyrin IX (PpIX) production is being explored for tumor fluorescence imaging and photodynamic therapy (PDT). As a prodrug, ALA is converted in heme biosynthesis pathway to PpIX with fluorescent and photosensitizing properties. To better understand the role of heme biosynthesis enzymes in ALA-mediated PpIX fluorescence and PDT efficacy, we used lentiviral shRNA to silence the expression of porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD) and ferrochelatase (FECH) in SkBr3 human breast cancer cells. PBGS and PBGD are the first two cytosolic enzymes involved in PpIX biosynthesis, and FECH is the enzyme responsible for converting PpIX to heme. PpIX fluorescence was examined by flow cytometry and confocal fluorescence microscopy. Cytotoxicity was assessed after ALA-mediated PDT. Silencing PBGS or PBGD significantly reduced ALA-stimulated PpIX fluorescence, whereas silencing FECH elevated basal and ALA-stimulated PpIX fluorescence. However, compared with vector control cells, the ratio of ALA-stimulated fluorescence to basal fluorescence without ALA was significantly reduced in all knockdown cell lines. PBGS or PBGD knockdown cells exhibited significant resistance to ALA-PDT, while increased sensitivity to ALA-PDT was found in FECH knockdown cells. These results demonstrate the importance of PBGS, PBGD and FECH in ALA-mediated PpIX fluorescence and PDT efficacy.

show abstract

Section: Discussionmentioning

confidence: 99%

Effects of Silencing Heme Biosynthesis Enzymes on 5‐Aminolevulinic Acid‐mediated Protoporphyrin IX Fluorescence and Photodynamic Therapy

Yang

Palasuberniam

et al. 2015

Photochem & Photobiology

View full text Add to dashboard Cite

show abstract

“…This enzyme catalyzes the insertion of ferrous iron into the protoporphyrin Ⅸ ring to form heme ( Figure 1) [4,5] . FECH expression has a heme-dependent negative feedback regulation at a posttranscriptional level in such a way that FECH is decreased by increasing the level of intracellular heme [6] . EPP exhibits both recessive and dominant patterns of inheritance and a high degree of allelic heterogeneity with incomplete penetrance.…”

Section: Reviewmentioning

confidence: 99%

Liver disease and erythropoietic protoporphyria: A concise review

Casanova

Trapero-Marugán²,

Jones³

et al. 2010

WJG

View full text Add to dashboard Cite

The porphyries are a group of metabolic disorders characterized by deficiencies in the activity of enzymes involved in the biosynthesis of heme. In erythropoietic protoporphyria (EPP), in the majority of cases an autosomal dominant disease, there is a mutation of the gene that encodes ferrochelatase (FECH). FECH deficiency is associated with increased concentrations of protoporphyrin in erythrocytes, plasma, skin and liver. The prevalence of this inherited disorder oscillates between 1:75 000 and 1:200 000. Clinical manifestations of EPP appear in early infancy upon first exposure to the sun. Nevertheless, approximately 5%-20% of patients with EPP develop liver manifestations. Retention of protoporphyrin in the liver is associated with cholestatic phenomena and oxidative stress that predisposes to hepatobiliary disease of varying degrees of severity, such as cholelithiasis, mild parenchymal liver disease, progressive hepatocellular disease with end-stage liver disease and acute liver failure. Liver damage is the major risk in EPP patients, so surveillance and frequent clinical and biochemical liver follow-up is mandatory. The diagnostic approach consists in detecting increased levels of protoporphyrin, decreased activity of FECH and genetic analysis of the FECH gene. A variety of non-surgical therapeutic approaches have been adopted for the management of EPP associated with liver disease, but none of these has been shown to be unequivocally efficacious. Nevertheless, some may have a place in preparing patients for liver transplantation. Liver transplantation does not correct the constitutional deficiency of FECH. Consequently, there is a risk of recurrence of liver disease after liver transplantation as a result of continuing overproduction of protoporphyrin. Some authors recommend that bone marrow transplantation should be considered in liver allograft recipients to prevent recurrence of hepatic disease.

show abstract

“…Human epithelial cervical cancer HeLa cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with fetal calf serum (FCS) and antibiotics. The cells (1 × 10 5 ) in a 1.5‐cm‐diameter dish were transfected using Lipofectamine 2000 (Invitrogen Co., San Jose, CA) with the indicated plasmid then incubated in the presence of 10% FCS at 37°C for 16–24 h (26). The cells also transfected with siRNAs were cultured for 48 h. The cells were then incubated in the absence or presence of ALA (0.5–1 m m ) for 16 h before being exposed to light, as described previously (7,8).…”

mentioning

confidence: 99%

“…Reverse transcriptase (RT)‐PCR analysis. Total RNA was isolated from the cells by the guanidium isothiocyanate method (26). Single‐strand cDNA derived from the RNA was synthesized with the oligo (dT) primer, using ReveTra Ace (Toyobo, Co., Tokyo, Japan), followed by PCR, using the indicated primers.…”

mentioning

confidence: 99%

“…To obtain the full‐length cDNA fragment of human mitoferrin‐2, PCR reaction was performed with the following primers: 5′‐AATCTAGAGAGTTGGAGGGGCGGGGT‐3 and 5′‐AAAAGCTTGCCAGCCCTCCACTCT‐3′ for mitoferrin‐2 and human kidney cDNA library as a template. Then, to make mammalian expression vector carrying mitoferrin‐2 containing an HA‐tag at the C‐terminus, the amplified cDNA was ligated into the Xba I /Hind III site of the vector pCG‐C‐HA (26).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Roles of Porphyrin and Iron Metabolisms in the δ‐Aminolevulinic Acid (ALA)‐induced Accumulation of Protoporphyrin and Photodamage of Tumor Cells

Ohgari

Miyata

Miyagi

et al. 2011

Photochem & Photobiology

View full text Add to dashboard Cite

δ-Aminolevulinic acid (ALA)-induced porphyrin accumulation is widely used in the treatment of cancer, as photodynamic therapy. To clarify the mechanisms of the tumor-preferential accumulation of protoporphyrin, we examined the effect of the expression of heme-biosynthetic and -degradative enzymes on the ALA-induced accumulation of protoporphyrin as well as photodamage. The transient expression of heme-biosynthetic enzymes in HeLa cells caused variations of the ALA-induced accumulation of protoporphyrin. When ALA-treated cells were exposed to white light, the extent of photodamage of the cells was dependent on the accumulation of protoporphyrin. The decrease of the accumulation of protoporphyrin was observed in the cells treated with inducers of heme oxygenase (HO)-1. The ALA-dependent accumulation of protoporphyrin was decreased in HeLa cells by transfection with HO-1 and HO-2 cDNA. Conversely, knockdown of HO-1/-2 with siRNAs enhanced the ALA-induced protoporphyrin accumulation and photodamage. The ALA effect was decreased with HeLa cells expressing mitoferrin-2, a mitochondrial iron transporter, whereas it was enhanced by the mitoferrin-2 siRNA transfection. These results indicated that not only the production of porphyrin intermediates but also the reuse of iron from heme and mitochondrial iron utilization control the ALA-induced accumulation of protoporphyrin in cancerous cells.

show abstract

Post-Transcriptional Regulation of the Expression of Ferrochelatase by Its Variant mRNA

Cited by 3 publications

References 23 publications

Effects of Silencing Heme Biosynthesis Enzymes on 5‐Aminolevulinic Acid‐mediated Protoporphyrin IX Fluorescence and Photodynamic Therapy

Effects of Silencing Heme Biosynthesis Enzymes on 5‐Aminolevulinic Acid‐mediated Protoporphyrin IX Fluorescence and Photodynamic Therapy

Liver disease and erythropoietic protoporphyria: A concise review

Roles of Porphyrin and Iron Metabolisms in the δ‐Aminolevulinic Acid (ALA)‐induced Accumulation of Protoporphyrin and Photodamage of Tumor Cells

Contact Info

Product

Resources

About