Population expansion and individual age affect endoparasite richness and diversity in a recolonising large carnivore population

Abstract

The recent recolonisation of the Central European lowland (CEL) by the grey wolf (Canis lupus) provides an excellent opportunity to study the effect of founder events on endoparasite diversity. Which role do prey and predator populations play in the re-establishment of endoparasite life cycles? Which intrinsic and extrinsic factors control individual endoparasite diversity in an expanding host population? In 53 individually known CEL wolves sampled in Germany, we revealed a community of four cestode, eight nematode, one trematode and 12 potential Sarcocystis species through molecular genetic techniques. Infections with zoonotic Echinococcus multilocularis, Trichinella britovi and T. spiralis occurred as single cases. Per capita endoparasite species richness and diversity significantly increased with population size and changed with age, whereas sex, microsatellite heterozygosity, and geographic origin had no effect. Tapeworm abundance (Taenia spp.) was significantly higher in immigrants than natives. Metacestode prevalence was slightly higher in ungulates from wolf territories than from control areas elsewhere. Even though alternative canid definitive hosts might also play a role within the investigated parasite life cycles, our findings indicate that (1) immigrated wolves increase parasite diversity in German packs, and (2) prevalence of wolf-associated parasites had declined during wolf absence and has now risen during recolonisation.

Recolonizing gray wolves increase parasite infection risk in their prey

“…Wolves were collected as roadkills or as confiscated poached animals originating from five federal states in northern and eastern Germany (50°10′–54°54′ N and 6°41′–15°2′ E). Wolf age classes (pup, yearling, adult) were determined as previously described (Lesniak, Heckmann et al., 2017). …”

“…DNA eluates (tongue, diaphragm, heart) were pooled per individual for subsequent PCR screening. Sarcocystis 18S rRNA gene amplification was performed using a set of three primer pairs (proti15F: 5′–TGCCAGTAGTCATATGCTTGTYT–3′, proti440R: 5′–CAGGCYCSCTCTCCGGA–3′ (Lesniak, Heckmann et al., 2017), SarAF: 5′–CTGGTTGATCCTGCCAGTAG–3′, SarAR: 5′–TTCCCATCATTCCAATCACT–3′, SarBF: 5′–GGGAGGTAGTGACAAGAAATAACAA–3′, SarBR: 5′–GGCAAATGCTTTCGCAGTAG–3′ (both primer pairs taken from Kutkiene et al. 2010) which anneal within conserved gene regions.…”

“…Parasites could either adapt to alternative hosts or disappear overtime (Farrell, Stephens, Berrang‐Ford, Gittleman, & Davies, 2015), which we call the “host flexibility” hypothesis and the “fading out” hypothesis, respectively. Wolves are definitive hosts for a wide range of endoparasites (Craig & Craig, 2005), but little is known about their possible influence on parasite prevalence in their ungulate prey if these serve as intermediate hosts, as in the case of helminths or apicomplexa (Lesniak, Heckmann et al., 2017). In particular, it is unclear whether infection risk increases when a definitive host returns after being absent from a specific area for some time, and how infection risk varies among different prey species.…”

“…They may therefore serve as potential intermediate hosts of wolf‐transmitted endoparasites such as helminth metacestodes of Taenia spp. (Lesniak, Heckmann et al., 2017) or Echinococcus spp. (Onac, Győrke, Oltean, Gavrea, & Cozma, 2013), and protozoan cysts of Neospora spp.…”

“…Free‐ranging wolves from the CEL population host at least 12 different Sarcocystis species (Lesniak, Heckmann et al., 2017). The genus Sarcocystis has an obligatory two‐host life cycle involving (partially) carnivorous definitive hosts and a broad range of intermediate hosts such as reptiles, birds, or mammals (Dubey & Lindsay, 2006; Munday, Hartley, Harrigan, Presidente, & Obendorf, 1979).…”