Population Control of Resident and Immigrant Microglia by Mitosis and Apoptosis

Abstract

Microglial population expansion occurs in response to neural damage via processes that involve mitosis and immigration of bone marrow-derived cells. However, little is known of the mechanisms that regulate clearance of reactive microglia, when microgliosis diminishes days to weeks later. We have investigated the mechanisms of microglial population control in a welldefined model of reactive microgliosis in the mouse dentate gyrus after perforant pathway axonal lesion. Unbiased stereological methods and flow cytometry demonstrate significant lesion-induced increases in microglial numbers. Reactive microglia often occurred in clusters, some having recently incorporated bromodeoxyuridine, showing that proliferation had occurred. Annexin V labeling and staining for activated caspase-3 and terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling showed that apoptotic mechanisms participate in dissolution of the microglial response. Using bone marrow chimeric mice, we found that the lesion-induced proliferative capacity of resident microglia superseded that of immigrant microglia, whereas lesion-induced kinetics of apoptosis were comparable. Microglial numbers and responses were severely reduced in bone marrow chimeric mice. These results broaden our understanding of the microglial response to neural damage by demonstrating that simultaneously occurring mitosis and apoptosis regulate expansion and reduction of both resident and immigrant microglial cell populations. (Am J Pathol

Microglia Protect Neurons against Ischemia by Synthesis of Tumor Necrosis Factor

“…Irradiated recipients (9.5 Gy from a 137 Cs source) were transplanted with ϳ10 7 donor BM cells into the lateral tail veins (Wirenfeldt et al, 2007). Recipients were given oxytetracycline (2 g/L Terramycin vet.…”

“…The ipsilateral and contralateral cortices were dissected from PBS-perfused CNS. Blood samples were collected from BMchimeric mice for validation of chimerism as described previously (Wirenfeldt et al, 2007). Single-cell suspensions were obtained by homogenization through 70 m nylon cell strainers (BD Falcon) in RPMI medium containing 10% FCS and blocked and stained for surface markers as described previously (Babcock et al, 2006;Wirenfeldt et al, 2007).…”

“…The brainstem was transected at the level of the superior colliculi, and ipsilateral and contralateral hemispheres were immersed in RNAlater Stabilization Reagent (Qiagen) for total RNA extraction and cDNA synthesis as described previously (Clausen et al, 2005). Quantitative PCR was performed on an iCycler (Bio-Rad) with published primer and probe sequences (Clausen et al, 2005;Lambertsen et al, 2007), except for TNF mRNA (primer set, TCTTCTCATTCCTGCTTGTGGC and AGGCCATTTGGGAACTTCTCATC; probe sequence, CCAC-CACGCTCTTCTGTCTACTGAACTTCGG), inducible nitric oxide synthase (iNOS) mRNA (primer set, GGACAGCACAGAATGTTCCAGAA and CAAAATCTCTCCACTGCCCCAG), and Toll-like receptor 2 (TLR2) mRNA (primer set, AAACCTCAGACAAAGCGTCAAATC and GTTTGCTGAAGAGGACTGTTATG), with the latter two performed using SYBR Green instead of TaqMan probes (Wirenfeldt et al, 2007). Values were normalized to HPRT1 as the reference gene and calibrated to a pool of cDNA from unmanipulated C57BL/6 mice.…”

“…Blood samples were collected from BMchimeric mice for validation of chimerism as described previously (Wirenfeldt et al, 2007). Single-cell suspensions were obtained by homogenization through 70 m nylon cell strainers (BD Falcon) in RPMI medium containing 10% FCS and blocked and stained for surface markers as described previously (Babcock et al, 2006;Wirenfeldt et al, 2007). For tissues intended for intracellular staining, 1 l/ml BD GolgiPlug with brefeldin A (BD Biosciences) was included during dissociation and incubation, which took place at 37°C with 5% CO 2 for 4.5 h without additional stimulation.…”

Injury-Induced Type I IFN Signaling Regulates Inflammatory Responses in the Central Nervous System

“…A well-established and widely used model to study the glial response after brain injury is an entorhinal axonal lesion. The transection of projections from entorhinal cortex to the hippocampus leads to anterograde axonal degeneration and loss of synapses in the outer molecular layer of the dentate gyrus, followed by glial activation, leukocyte infiltration, and sprouting (13)(14)(15)(16)(17)(18)(19)(20). Involvement of TLR signaling as well as cytokines (TNF-a and IL-1b) and chemokines (CCL2 and CXCL10) in glial response and recruitment of leukocytes in the lesion-reactive hippocampus have been described previously (15,17,21,22).…”