Polyproteins containing a domain encoded by the V-SKI oncogene are located in the nuclei of SKV-transformed cells

Transcriptional Repression by v-Ski and c-Ski Mediated by a Specific DNA Binding Site

“…However, there are now numerous examples of transcription factors that can act as either activators or repressors depending on protein-protein interactions dictated by the promoter and physiological context (48). Although Ski appears to activate transcription by interacting with other DNA-bound transcription factors, including the myogenic regulatory factors (13) and members of the NFI family (15), 2 we have been unable to identify an activation domain by fusing various regions of Ski with an independent DNA binding domain (data not shown). In the case of repression through binding to the GTCT binding site, Ski's action appears to be different.…”

“…v-Ski is a truncated form of the c-Ski protein that is missing 20 amino acids from the amino terminus and 292 amino acids from the carboxyl terminus (2)(3)(4). This truncation, which removes a carboxyl-terminal dimerization domain, plays no role in the activation of ski as an oncogene (5,6).…”

“…In addition, we have shown that Ski can interact with the DNA binding site for the nuclear factor I (NFI) transcription factor family by protein-protein interaction with the NFI protein and potentiate NFI-stimulated transcription of a reporter that has multimerized NFI binding sites upstream of a TATA box element (15). 2 Recently, it has become clear that some transcription factors can regulate gene expression by interacting with multicomponent protein complexes (16 -18). This allows a single transcription factor to interact with different binding sites, depending on the cellular context.…”

Ski acts as a co-repressor with Smad2 and Smad3 to regulate the response to type β transforming growth factor

“…T he products of the cellular and retroviral ski genes are nuclear proteins that either activate or repress transcription, depending on the cellular and promoter context (1)(2)(3)(4)(5)(6). The v-Ski oncoprotein of the SKV retrovirus (7) is truncated by 312 amino acids relative to its cellular homolog, c-Ski (8), but this truncation per se is not oncogenic.…”

The Ski oncoprotein interacts with Skip, the human homolog of Drosophila Bx42

“…To construct yeast expression plasmids containing GAL4-Ski fusion genes, Ski speci®c primers were used in a PCR reaction to amplify v-Ski sequence from the plasmid pRAVSKV (Stavnezer et al, 1986) and c-Ski sequence from the plasmid pKS29 (Sutrave and Hughes, 1989). Forward and reverse primers used (i) c-Ski: TCCCCCGGGGATGGAGACTGTAAGTAGA and AC-GCGTCGACTTAATTCTCCATGTTGCT; (ii) v-Ski: GG-CCCGGGGTTTCATCTGAGCTCTATG and GGGTCG-ACGCACCACTGTGGCACAGGG.…”