Polymorphisms of the IL-6, IL-8 and IL-10 genes and the risk of gastric pathology in patients infected with Helicobacter pylori

Ramis, Ivy Bastos; Vianna, Júlia Silveira; Gonçalves, Carla Vitola; Groll, Andréa von; Dellagostin, Odir A.; Silva, Pedro Eduardo Almeida da

doi:10.1016/j.jmii.2015.03.002

Cited by 63 publications

(60 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Recent studies have indicated that polymorphisms in IL-8 could influence the development of various diseases, including acne vulgaris, glioma, gastric diseases, periodontitis, osteoarthritis, ovarian cancer, and oral cancer, as well as acute pancreatitis He et al, 2014;Chen et al, 2015;Hussain et al, 2015;Koensgen et al, 2015;Liu et al, 2015;Ramis et al, 2015). Wang et al (2013) observed, in a meta-analysis of 1324 patients with oral cancer and 1879 healthy controls, that the AA and AT genotypes of IL-8 rs4073 was correlated with an increased risk of oral cancer in a Caucasian population.…”

Section: Discussionmentioning

confidence: 99%

Role of IL-8 rs4073 and rs2227306 polymorphisms in the development of primary gouty arthritis in a Chinese population

2016

View full text Add to dashboard Cite

ABSTRACT. In this study, we investigated the role of two single nucleotide polymorphisms in the promoter region of the interleukin-8 gene (IL-8; rs4073 and rs2227306) in the susceptibility to primary gouty arthritis in a Chinese population. Three hundred and twelve patients with primary gouty arthritis and 340 healthy controls were recruited from the Yan'an University Affiliated Hospital between January 2014 and March 2015. The IL-8 rs4073 and rs2227306 polymorphisms were genotyped by polymerase chain reaction combined with restriction fragment length polymorphism. Unconditional multiplelogistic regression analysis revealed that the TT genotype of rs4073 was correlated with primary gouty arthritis risk, compared to the AA genotype [adjusted odds ratio (OR) = 1.65, 95% confidence interval (CI) = 1.08-2.54; P = 0.02]. In addition, the IL-8 rs4073 T allele was associated with a significant elevated risk of primary gouty arthritis, in comparison to the A allele (OR = 1.34, 95%CI = 1.07-1.67; P = 0.01). However, we observed no significant relationship between the IL-8 2 Y.X. Cui et al.Genetics and Molecular Research 15 (4): gmr15048511 rs2227306 polymorphism and primary gouty arthritis risk. The results of this study suggest that the IL-8 rs4073 polymorphism could be a marker for primary gouty arthritis development.

show abstract

Section: Discussionmentioning

confidence: 99%

Role of IL-8 rs4073 and rs2227306 polymorphisms in the development of primary gouty arthritis in a Chinese population

2016

View full text Add to dashboard Cite

show abstract

“…GTTTTTGATGCATGGGATTT GTGCATCTCTTATGGCTTT 401 94 (10) 94 (60) 56 (60) 72 (60) 35 72 (10) [28] PCR: Polymerase chain reaction of H. pylori infections was confirmed by PCR analysis using specific primers for 16SrRNA, ureC, and ureA genes. The identification results showed 49 (65.3%) out of 75 biopsies gave positive results for at least two genetic markers including gastritis (55.26%) and PUD (100%) infections, but not the others [28].…”

Section: Resultsmentioning

confidence: 99%

“…So both ureA and ureC considered "housekeeping" genes. However, they have been extensively used for confirming the presence of H. pylori [9,10].…”

Section: Introductionmentioning

confidence: 99%

INVESTIGATION OF Helicobacter pylori VIRULENCE GENOTYPE IN GASTRIC BIOPSIES BY PCR

Omran

2016

Asian J Pharm Clin Res

View full text Add to dashboard Cite

Objectives: Helicobacter pylori infections have been associated with the genetic diversity of their virulence factors; the virulence genotypes are valuable as a molecular marker in the diagnosis of patients with bacterial infections. Our main objective was to analyze the frequency and allelic genotype of vacuolating cytotoxin A (vacA) and cytotoxin-associated gene A (cagA) as well as investigate other virulence genes like outer inflammatory protein A gene (oipA) and a gene contact with the epithelium (iceA) of H. pylori. Methods:A total of 75 patients with gastritis and peptic ulcer diseases (PUDs) were selected to investigate H. pylori infections. 75 antrum biopsies were collected from these patients, and then genomic DNA was extracted from biopsies using the genomic DNA kit. Subsequently, the virulence genes of H. pylori were amplified using specific primers for vacA, cagA, cagE, iceA, and oipA by polymerase chain reaction (PCR).Results: A high prevalence of genes cagA (28.6%), vacAs1bm2 (44.68%), iceA2 (30.6%), and oipA (42.9%) was found, while vacA s2m1 and iceA1 genotypes was not found in our study. There was a significant correlation between the presence of cagA and cagE genotypes (p=0.02), suggesting that these two genes almost used together as a cagPAI integrity marker and the predominant cagA EPIYA motif was ABC (~650 bp) belong to Western cagA strains. The presence of the cagA + and vacA + genes was significantly associated with peptic ulceration (p≤0.001 at a level 0.01 and p≤0.044 at a level 0.05, respectively), whereas different iceA2 genotype was no statistically significant with clinical outcome. Patients with PUD more likely to have an oipA gene (61.9%) than those with gastritis (38.1%), p≤0.037, also the presence oipA gene was statistically significant with presence iceA2 and cagA, as well as the presence iceA gene was statistically significant with the presence vacA. Conclusion: Most H. pylori genotypes which associated with peptic ulcer and gastritis were moderate virulent strains, whereas the virulent strain which associated with peptic ulcer belong to Western cagA strains had vacAs1bm2 genotype, oipA and iceA2 genes that rarely induced gastric cancer in the middle region of Iraq.

show abstract

“…Previous studies have examined associations between the IL-10 -592A/C, -819C/T, and -1082A/G polymorphisms and several conditions related to inflammation, including deep venous thrombosis, chronic hepatitis B virus infection, sepsis, Helicobacter pylori infection, valvular calcification, and peptic ulcer diseases (Tang et al, 2014;Tunçbilek, 2014;An et al, 2015;Miftahussurur and Yamaoka, 2015;Pan et al, 2015;Ramis et al, 2015). For instance, Tang et al (2014) carried out an investigation of 660 deep venous thrombosis patients and 660 control subjects, from which they found that the IL-10 -1082A/G polymorphism is associated with risk of this disease among Chinese individuals.…”

Section: Discussionmentioning

confidence: 99%

“…Tunçbilek (2014) revealed that sequence variations in this same gene are involved in different clinical presentations of HBV infection, while Pan et al (2015) conducted a meta-analysis indicating that IL-10 -592A/C and -1082A/ G polymorphisms can affect susceptibility to sepsis. Ramis et al (2015) failed to identify a significant association between IL-10 gene variants and H. pylori infection; however, An et al (2015) reported that IL-10 -592A/C and -819C/T polymorphisms can influence valvular calcification risk in Han and Kazak populations. Finally, Miftahussurur and Yamaoka (2015) found no significant association between IL-10 genetic variations and peptic ulcer disease.…”

Section: Discussionmentioning

confidence: 99%

Association between IL-10 genetic variations and cervical cancer susceptibility in a Chinese population

Cy¹,

Xy²,

He³

et al. 2016

Genet. Mol. Res.

View full text Add to dashboard Cite

ABSTRACT.We conducted an investigation into the role of the IL-10 polymorphisms -592A/C (rs1800872), -819C/T (rs1800871), and -1082A/G (rs1800896) in cervical cancer risk in a Chinese population. A case-control study was carried out, including 165 newly diagnosed cervical cancer patients and 165 control subjects. The polymerase chain reaction-restriction fragment length polymorphism method was used to genotype the three IL-10 variant loci. Using conditional logistic regression analysis, we observed that homozygous IL-10 -819C/T TT carriers were at significantly increased risk of cervical cancer compared to homozygous CC individuals, with an adjusted odds ratio (OR) of 2.23 and a 95% confidence interval (CI) of 1.16-4.30. Moreover, the CT+TT genotype was significantly associated with cervical cancer in comparison to the wild-type variant (OR = 1.69, 95%CI = 1.04-2.76; P = 0.03). In conclusion, our study suggests that the IL-10 -819C/T 2 C.Y. Bai et al. Genetics and Molecular Research 15 (3): gmr.15038116 genetic variation may contribute to cervical cancer risk in the Chinese population examined.

show abstract

Polymorphisms of the IL-6, IL-8 and IL-10 genes and the risk of gastric pathology in patients infected with Helicobacter pylori

Abstract: We demonstrated that polymorphisms in the IL-8 gene was significantly associated with H. pylori infection. Furthermore, polymorphisms in the IL-8 and IL-10 genes were associated with an enhanced risk of peptic ulcer disease in H. pylori-positive patients.

Cited by 63 publications

References 42 publications

Role of IL-8 rs4073 and rs2227306 polymorphisms in the development of primary gouty arthritis in a Chinese population

Role of IL-8 rs4073 and rs2227306 polymorphisms in the development of primary gouty arthritis in a Chinese population

INVESTIGATION OF Helicobacter pylori VIRULENCE GENOTYPE IN GASTRIC BIOPSIES BY PCR

Association between IL-10 genetic variations and cervical cancer susceptibility in a Chinese population

Contact Info

Product

Resources

About