Polymorphisms in inhibin α gene promoter associated with male infertility

Li, Wanhong; Lu, Ciyong; Chen, Shuxiong; Li, Hongjiao; Zhuo, Lang; Sun, Lina; Zhao, Yun; Zheng, Lianwen; Li, Chunjin; Zhou, Xu

doi:10.1016/j.gene.2015.01.041

Cited by 5 publications

(16 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…c.‐124G>A (rs11893842) of INHα polymorphisms 21 was genotyped by PCR‐RFLP. The following set of oligonucleotide primers was used to determine c.‐124G>A : forward 5′‐AGGTCGCTTGAGGCGAAATCCTTCC‐3′ and reverse 5′‐TCCCACACCCACCCTCTTCTACCCTTCTGA‐3′ 21 . c.‐16 C>T (rs35118453) of INHα polymorphisms 21 was genotyped by PCR‐RFLP.…”

Section: Methodsmentioning

confidence: 99%

“…The concentration of Inhibin B in serum is also a key factor regulating sperm count. For instance, high sperm concentration may be present in individuals with higher levels of seminal inhibin while males with a spermatogenic defect may present with lower levels of inhibin B 20,21 …”

Section: Introductionmentioning

confidence: 99%

“…It is postulated that mutations in the inhibin genes lead to a reduction in circulating inhibins. This results in an increase in FSH levels causing alterations in follicle recruitment and premature depletion of the follicle pool, ultimately causing disturbances in the process of spermatogenesis 11‐15,21‐23 …”

Section: Introductionmentioning

confidence: 99%

“…Three variants (polymorphisms) of INHα genes, a coding variant 769G> A and two promoter allele variants 16C >T and 124G>A have been reported to be significantly associated with premature ovarian failure in females 12,14‐16,23,24 . However, scanty literature is available on the association between male infertility and the 124G>A polymorphism in the INHα gene 21 . To the best of the author’s knowledge, only a single study conducted in a Chinese population has investigated the associations between INHα‐c.‐124G>A and INHα ‐ c.‐16C>T and male infertility 21 …”

Section: Introductionmentioning

confidence: 99%

“…However, scanty literature is available on the association between male infertility and the 124G>A polymorphism in the INHα gene 21 . To the best of the author’s knowledge, only a single study conducted in a Chinese population has investigated the associations between INHα‐c.‐124G>A and INHα ‐ c.‐16C>T and male infertility 21 …”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Association of polymorphism c.‐124G>A and c.‐16 C>T in the promoter region of human INHA gene with altered sperm parameters; A pilot study

Rafaqat

Kayani

Fatima

et al. 2020

Int. J. Clin. Pract.

View full text Add to dashboard Cite

Objective The objective of this was to demonstrate the association of Inhibin α (INHα) c.‐124G>A and INHα‐c.‐16 C>T polymorphisms with altered sperm parameters in a selected male population of Karachi, Pakistan. Study Design & Settings In this pilot study, male subjects were stratified on the basis of the WHO criteria for altered sperm parameters; 83 (cases—altered sperm parameters) and 30 (controls—normal sperm parameters) subjects were included for analysis of INHα‐c.124G>A polymorphism and 88 (cases) and 38 (controls) were analysed for INHα ‐c‐16 C>T polymorphism. Genotyping of INHα‐c.‐124G>A and INHα‐c.‐16 C>T was performed by PCR‐RFLP, genotype distribution in Hardy‐Weinberg equilibrium was evaluated by binary logistic regression model. Results For the c.‐124G>A polymorphism in INHα gene, frequency of the three major genotypes in controls was: GG: 80.0%, GA: 20.0% and AA: 0% and in cases was: GG: 59.0%, GA: 30.2% and AA: 10.8%. The GG genotype was significantly associated with male infertility (P < .045, OR = 2.776, 95% CI = 1.025‐7.513) while the GA genotype was not significantly associated with infertility (P < .290 OR = 0.580, 95% CI = 0.211‐1.593). Frequency of mutant AA genotype was 10.8% in cases (altered sperm parameters) and absent (0%) in normal sperm parameter (controls). The frequencies of three major genotypes CC, CT and TT did not show any significant difference between cases and controls (P > .05). Conclusion The results from our study exhibited a significant association of c.‐124G>A polymorphism in the INHα gene promoter region with male infertility in the Pakistani population. A significant association of c.‐16 C>T polymorphism with male infertility, however, was not observed. Further large‐scale studies should be conducted to confirm this association.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Association of polymorphism c.‐124G>A and c.‐16 C>T in the promoter region of human INHA gene with altered sperm parameters; A pilot study

Rafaqat

Kayani

Fatima

et al. 2020

Int. J. Clin. Pract.

View full text Add to dashboard Cite

show abstract

Association analysis between reproduction genes INHA , PGR , RARG with lamb and other traits of Liaoning cashmere goats

Chen

Liu

Zhang

et al. 2022

Animal Biotechnology

View full text Add to dashboard Cite

Human INHBB Gene Variant (c.1079T>C:p.Met360Thr) Alters Testis Germ Cell Content, but Does Not Impact Fertility in Mice

et al. 2022

View full text Add to dashboard Cite

Testicular derived inhibin B (α/βB dimers) acts in an endocrine manner to suppress pituitary production of follicle stimulating hormone (FSH), by blocking the actions of activins (βA/B/βA/B dimers). Previously, we identified a homozygous genetic variant (c.1079T>C:p.Met360Thr) arising from uniparental disomy of chromosome 2 in the INHBB gene (βB-subunit of inhibin B and activin B) in a man suffering from infertility (azoospermia). In this study, we aimed to test the causality of the p.Met360Thr variant in INHBB and testis function. Here, we used CRISPR/Cas9 technology to generate Inhbb M364T/M364T mice, where mouse INHBB p.Met364 corresponds with human p.Met360. Surprisingly, we found that the testes of male Inhbb M364T/M364T mutant mice were significantly larger compared with those of aged-matched wildtype littermates at 12 and 24 weeks of age. This was attributed to a significant increase in Sertoli cell and round spermatid number and, consequently, seminiferous tubule area, in Inhbb M364T/M364T males compared to wildtype males. Despite this testis phenotype, male Inhbb M364T/M364T mutant mice retained normal fertility. Serum hormone analyses however, indicated that the Inhbb M364T variant resulted in reduced circulating levels of activin B, but did not affect FSH production. We also examined the effect of this p.Met360Thr, and an additional INHBB variant (c.314C>T: p.Thr105Met) found in another infertile man, on inhibin B and activin B in vitro biosynthesis. It was found that both INHBB variants resulted in a significant disruption to activin B in vitro biosynthesis. Together, this analysis supports that INHBB variants that limit activin B production have consequences for testis composition in males.

show abstract

Polymorphisms in inhibin α gene promoter associated with male infertility

Cited by 5 publications

References 30 publications

Association of polymorphism c.‐124G>A and c.‐16 C>T in the promoter region of human INHA gene with altered sperm parameters; A pilot study

Association of polymorphism c.‐124G>A and c.‐16 C>T in the promoter region of human INHA gene with altered sperm parameters; A pilot study

Association analysis between reproduction genes INHA , PGR , RARG with lamb and other traits of Liaoning cashmere goats

Human INHBB Gene Variant (c.1079T>C:p.Met360Thr) Alters Testis Germ Cell Content, but Does Not Impact Fertility in Mice

Contact Info

Product

Resources

About

Polymorphisms in inhibin α gene promoter associated with male infertility

Cited by 5 publications

References 30 publications

Association of polymorphism c.‐124G>A and c.‐16 C>T in the promoter region of human INHA gene with altered sperm parameters; A pilot study

Association of polymorphism c.‐124G>A and c.‐16 C>T in the promoter region of human INHA gene with altered sperm parameters; A pilot study

Association analysis between reproduction genes INHA , PGR , RARG with lamb and other traits of Liaoning cashmere goats

Human INHBB Gene Variant (c.1079T&gt;C:p.Met360Thr) Alters Testis Germ Cell Content, but Does Not Impact Fertility in Mice

Contact Info

Product

Resources

About

Human INHBB Gene Variant (c.1079T>C:p.Met360Thr) Alters Testis Germ Cell Content, but Does Not Impact Fertility in Mice