Polycistronic RNA polymerase II expression vectors for RNA interference based on miR-155

Chung, Kwan-Ho; Hart, Christopher C.; Al-Bassam, Sarmad; Avery, Adam W.; Taylor, Jennifer; Patel, Paresh D.; Vojtek, Anne B.; Turner, David L.

doi:10.1016/j.ydbio.2006.04.346

Cited by 9 publications

(13 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Although delivery of a single miRNA can clearly produce a phenotypic disturbance, it has been suggested that miRNA regulation of a given transcript is most efficient when multiple miRNAs work in concert (1)(2)(3). With such recent technological advancements as the delivery of multiple miRNAs from a single polycistronic construct (31), future efforts directed toward delivery of multiple and coordinately targeted miRNAs are anticipated to not only enhance the utility of miRNAs as research tools but also provide further rationale for the design of new therapies that modulate miRNA expression.…”

Section: Discussionmentioning

confidence: 99%

Coordinate Suppression of ERBB2 and ERBB3 by Enforced Expression of Micro-RNA miR-125a or miR-125b

Scott

Goga

Bhaumik

et al. 2007

Journal of Biological Chemistry

579

481

View full text Add to dashboard Cite

Deregulation of micro-RNAs (miRNAs) is emerging as a major aspect of cancer etiology because their capacity to direct the translation and stability of targeted transcripts can dramatically influence cellular physiology. To explore the potential of exogenously applied miRNAs to suppress oncogenic proteins, the ERBB oncogene family was chosen with a bioinformatics search identifying targeting seed sequences for miR-125a and miR-125b within the 3 -untranslated regions of both ERBB2 and ERBB3. Using the human breast cancer cell line SKBR3 as a model for ERBB2 and ERBB3 dependence, infection of these cells with retroviral constructs expressing either miR-125a or miR-125b resulted in suppression of ERBB2 and ERBB3 at both the transcript and protein level. Luciferase constructs containing the 3 3 -untranslated regions of ERBB2 and ERBB3 demonstrated ϳ35% less activity in miR-125a-and miR-125b-expressing cells relative to controls. Additionally, phosphorylation of ERK1/2 and AKT was suppressed in SKBR3 cells overexpressing either miR-125a or miR-125b. Consistent with suppression of both ERBB2 and ERBB3 signaling, miR-125a-or miR-125b-overexpressing SKBR3 cells were impaired in their anchoragedependent growth and exhibited reduced migration and invasion capacities. Parallel studies performed on MCF10A cells demonstrated that miR-125a or miR-125b overexpression produced only marginal influences on the growth and migration of these non-transformed human mammary epithelial cells. These results illustrate the feasibility of using miRNAs as a therapeutic strategy to suppress oncogene expression and function.

show abstract

Section: Discussionmentioning

confidence: 99%

Coordinate Suppression of ERBB2 and ERBB3 by Enforced Expression of Micro-RNA miR-125a or miR-125b

Scott

Goga

Bhaumik

et al. 2007

Journal of Biological Chemistry

579

481

View full text Add to dashboard Cite

show abstract

“…Short-hairpin RNAs were designed based on mouse PDE5A sequence (shRNA PDE5-1899 : FORWARD 5′-TGCTGTTTCAGAGCAGCAAACATGCAGTTTTGGCCACTGACTGACTGCATG TTCTGCTCTGAAA-3′ and REVERSE 5′-CCTGTTTCAGAGCAGAACATGCAGTCAGTCAGTGGCCAAAACTGCATGTTTGCTGCTCTGAAAC-3′; shRNA PDE5-2066 FORWARD 5′-TGCTGAAATGATGGTGTTCCATGATGGTTTTGGCCACTGACTGACCATCATGGCACCATCATTT-3′ and REVERSE 5′-CCTGAAATGATGGTGCCATGATGGTCAGTCAGTGGCCAAAACCATCATGGAA-3′)and inserted into pcDNA 6.2-GW/EmGFP-miR-155 vector (Invitrogen) [26] retaining miRNA regulatory sequences required for efficient shRNA processing (Fig 1A). This was transferred by recombinase cloning into pAd/CMV/V5-DEST™ vector (Invitrogen) to generate AdV- gfp -shRNA PDE5a .…”

Section: Methodsmentioning

confidence: 99%

Expression, activity, and pro-hypertrophic effects of PDE5A in cardiac myocytes

Zhang

Koitabashi

Nagayama

et al. 2008

Cellular Signalling

View full text Add to dashboard Cite

Cyclic GMP-selective phosphodiesterase type 5 (PDE5) has been traditionally thought to play little role in cardiac myocytes, yet recent studies using selective inhibitors such as sildenafil suggest it can potently modulate acute and chronic cardiac stress responses. To date, evidence for myocyte PDE5 expression and regulation has relied on small-molecule inhibitors and anti-sera, leaving open concerns regarding non-specific immune-reactivity, and off-target drug effects. To directly address both issues, we engineered a robust PDE5-gene silencing shRNA (inserted into miRNA-155 cassette) and DsRed-PDE5 fusion protein, both coupled to a CMV promoter and incorporated into adenoviral vectors. PDE5 mRNA and protein knockdown eliminated anti-sera positivity on immunoblots and fluorescent immuno-histochemistry in neonatal and adult cardiomyocytes, and suppressed PDE5 enzyme activity. Stimulation of myocyte hypertrophy by phenylephrine was blunted by PDE5 gene silencing in a protein kinase G dependent manner, and this effect was similar to that from sildenafil with no additive response by both combined. DsRed-PDE5 fusion protein expression showed normal z-band localization in adult myocytes but was diffuse in eNOS -/-myocytes; echoing reported findings with anti-sera. PDE5 over-expression increased enzyme activity and amplified natriuretic peptide gene expression from phenylephrine stimulation. These data confirm PDE5 expression, activity, and targeted inhibition by sildenafil in cardiomyocytes, as well as the role of this PDE in cardiomyocyte hypertrophy modulation.

show abstract

“…In this way, a reporter such as GFP or a relevant functional protein can be expressed with the shRNA at the same time. Secondly, polycistronic expression becomes possible, that is, more than one microRNA‐type shRNA can be expressed at the same time from a single transcript 85. In this manner, either several genes can be silenced at once or a target gene can be very efficiently inhibited by several shRNAs.…”

Section: Vector Expression Of Shrnasmentioning

confidence: 99%

RNA Interference: From Basic Research to Therapeutic Applications

2009

View full text Add to dashboard Cite

An efficient mechanism for the sequence-specific inhibition of gene expression is RNA interference. In this process, double-stranded RNA molecules induce cleavage of a selected target RNA (see picture). This technique has in recent years developed into a standard method of molecular biology. Successful applications in animal models have already led to the initiation of RNAi-based clinical trials as a new therapeutic option.Only ten years ago Andrew Fire and Craig Mello were able to show that double-stranded RNA molecules could inhibit the expression of homologous genes in eukaryotes. This process, termed RNA interference, has developed into a standard method of molecular biology. This Review provides an overview of the molecular processes involved, with a particular focus on the posttranscriptional inhibition of gene expression in mammalian cells, the possible applications in research, and the results of the first clinical studies.

show abstract

Polycistronic RNA polymerase II expression vectors for RNA interference based on miR-155

Cited by 9 publications

References 0 publications

Coordinate Suppression of ERBB2 and ERBB3 by Enforced Expression of Micro-RNA miR-125a or miR-125b

Coordinate Suppression of ERBB2 and ERBB3 by Enforced Expression of Micro-RNA miR-125a or miR-125b

Expression, activity, and pro-hypertrophic effects of PDE5A in cardiac myocytes

RNA Interference: From Basic Research to Therapeutic Applications

Contact Info

Product

Resources

About