Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

Abstract

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Poly(ADP-ribosyl)ation by PARP-1: `PAR-laying' NAD+ into a nuclear signal

“…For example, both PARP-1 and PARP-2 localize to mitotic centromeres, the chromosomal regions where kinetochores form to capture microtubules from the mitotic spindle (Earle et al 2000;Saxena et al 2002a,b). In addition, several PARP enzymes, including PARP-1, PARP-3, and tankyrases, are associated with centrosomes, the cellular microtubule organizing center that functions as the spindle pole during mitosis (Smith and de Lange 1999;Kaminker et al 2001;Augustin et al 2003;Kanai et al 2003).…”

The PARP superfamily

“…Remarkably, a number of recently identified partners of PARP-1 and PARP-2 such as CENP-A, CENP-B, Bub 3 (41)(42)(43) and Aurora B (L. Monaco, R. Loury, J. Mé nissier-de Murcia, M.…”

Poly(ADP-Ribose) Polymerase 1 Binds to Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Terminal Repeat Sequence and Modulates KSHV Replication in Latency

“…In this report, we focused on PARP1 because it is reported to be a multifunctional protein and was recently found to act as a component of the centromere and the centrosome (21,30,47), which suggests that it may be a key factor for chromatin structure (51), replicated genome segregation, and partitioning (50), although it is best known as a target substrate for the caspases in apoptosis (53). In KSHV, a recent report showed that PARP1 interacts with RTA, an immediate-early protein that is a key factor for the induction of lytic replication (25).…”