Pneumocystis murina MSG gene family and the structure of the locus associated with its transcription

Keely, Scott P.; Linke, Michael J.; Cushion, Melanie T.; Stringer, James R.

doi:10.1016/j.fgb.2007.01.004

Cited by 14 publications

(12 citation statements)

References 91 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Microscope slides containing P. murina organisms were stained with Diff-Quik (Baxter Scientific, McGraw Park, IL), and nuclei were counted as described previously (17) and are expressed as numbers of nuclei per ml. Genomic DNA was extracted from P. murina as previously described (17). A 5′ region of the P. murina 18S rDNA locus (GenBank accession no.…”

Section: Rdna Copy Numbermentioning

confidence: 99%

“…The second transcribed spacer locus in AY532651 was amplified with primers ITS2For (5′ AGGTTCGTGTTGGGCTATGC 3′) and ITS2Rev (5′ ATTCAAAAAATCAGCTTAACATTTC 3′). Forty cycles of PCR were performed in the presence of SYBR green under the following conditions: 95°C for 15 s, 50°C for 15 s, and 72°C for 15 s. DNA plasmids containing these 18S rDNA and ITS2 targets were used as standards to establish a linear relationship between log-transformed numbers of copies of the target and PCR threshold cycles as previously described (17). …”

Section: Rdna Copy Numbermentioning

confidence: 99%

See 1 more Smart Citation

Assembly and Annotation of Pneumocystis jirovecii from the Human Lung Microbiome

Cushion

Keely

2013

mBio

Self Cite

View full text Add to dashboard Cite

Pneumocystis jirovecii is a fungus that causes Pneumocystis pneumonia in immunosuppressed patients and has been closely associated with AIDS since the beginning of the AIDS epidemic. Because in vitro cultivation of P. jirovecii is not possible, progress has been hindered in our understanding of its life cycle, mode of transmission, metabolic function, and genome. Limited amounts of P. jirovecii can be obtained from infected patients, but the occurrence of bacteria, other fungi, and human cells in clinical samples presents new challenges for whole-genome sequencing and downstream bioinformatic analysis. In a recent article, Cissé et al. used cell immunoprecipitation enrichment together with whole-genome amplification to generate sufficient quantities of DNA for Roche 454 and Illumina sequencing [O. H. Cissé, M. Pagni, and P. M. Hauser, mBio 4(1):e00428-12, 2012, doi:10.1128/mBio.00428-12]. In addition, a bioinformatic pipeline was devised to sort and assemble lung microbiome reads, thereby generating an 8.1-Mb P. jirovecii genome comprised of 356 contigs with an N50 (median length of all contigs) of 41.6 kb. Knowledge of this genome will open new avenues of research, including the identification of nutritional requirements for in vitro cultivation as well as the identification of new and novel drug and vaccine targets.

show abstract

Section: Rdna Copy Numbermentioning

confidence: 99%

Section: Rdna Copy Numbermentioning

confidence: 99%

Assembly and Annotation of Pneumocystis jirovecii from the Human Lung Microbiome

Cushion

Keely

2013

mBio

Self Cite

View full text Add to dashboard Cite

show abstract

“…The subtelomeric regions harbor tandemly repeated copies of several gene families (1,30,31,53), including the abundantly expressed major surface glycoproteins (MSGs), which play an important role in the host-parasite interaction and the escape from host responses during lung infection (20,58). Only a single copy of approximately 100 or so MSG genes is expressed at any one time; telomeric recombination appears to mediate the switching of different antigenic variants into the unique subtelomeric locus from which expression takes place (29,56,57,60). Whether the integrity of P. carinii telomere ends is maintained through telomerase-based addition of repeats or entirely by recombination is still unclear.…”

Section: The Tbf1p Family As Global Coordinators Of Gene Expressionmentioning

confidence: 99%

Functional Differentiation of tbf1 Orthologues in Fission and Budding Yeasts

et al. 2009

View full text Add to dashboard Cite

In Saccharomyces cerevisiae, TBF1, an essential gene, influences telomere function but also has other roles in the global regulation of transcription. We have identified a new member of the tbf1 gene family in the mammalian pathogen Pneumocystis carinii. We demonstrate by transspecies complementation that its ectopic expression can provide the essential functions of Schizosaccharomyces pombe tbf1 but that there is no rescue between fission and budding yeast orthologues. Our findings indicate that an essential function of this family of proteins has diverged in the budding and fission yeasts and suggest that effects on telomere length or structure are not the primary cause of inviability in S. pombe tbf1 null strains.The phylogenetic pedigree of Pneumocystis species implies they are likely to employ conserved fungus-specific proteins in pathways that are essential for viability. Identification of such modules in the genome of the rat-specific pathogen P. carinii may help to identify novel targets for directed pharmaceutical intervention to treat opportunistic infection of immunocompromised human hosts by P. jirovecii. To identify conserved functional modules, we are assessing the ability of genes from P. carinii to function in the budding yeast Saccharomyces cerevisiae as well as in the fission yeast Schizosaccharomyces pombe, the closest evolutionary relationship for which molecular genetic analysis is well developed (25,36).In the course of this study, we identified a potential homologue of the S. pombe tbf1 (Sptbf1) and S. cerevisiae TBF1 (ScTBF1) genes. Sequence comparisons indicate that both SpTbf1p and ScTbf1p are members of a conserved fungusspecific family (50, 51). All the Tbf1 family members contain a C-terminal "telobox" DNA binding domain (8, 9) but bear additional significant homology throughout their coding sequences. The telobox, a particular variant of the Myb family motif, is also found in the mammalian telomere factors TRF1 and TRF2 as well as in the fission yeast telomeric protein Taz1p (13). The telobox recognizes sequences similar to the mammalian telomeric repeat TTAGGG. High-affinity binding sites for ScTbf1p have also been identified in the STARs (subtelomeric antisilencing regions) of the subtelomeric X and YЈ elements. Several studies have proposed a regulatory role for ScTbf1p at telomeres (2,6,19,33). The ScTBF1 gene is essential, but this is commonly assumed to be due to its function as a global transcriptional regulator that binds to many sites throughout chromatin rather than to direct effects on telomeres (10, 33).SpTbf1p was identified in S. pombe whole-cell extracts as one of several activities that exhibited differential affinity in vitro for tandem copies of the human and S. pombe telomere repeat sequences (55, 62). The Sptbf1 gene is essential, although its full range of cellular functions is unknown. Overexpression of Sptbf1 has been shown to slightly increase the mean length of telomeres in vivo (51).We have examined whether the P. carinii tbf1 homologue (Pctbf1) can rescue ...

show abstract

“…MSG genes have been described in five other species of Pneumocystis, including the three that have received a species name other than " carinii", P. murina (found in the laboratory mouse) [ 56 ], P. wakefieldiae (found in the laboratory rat) [ 57 ] and P. jirovecii (found in human beings) [ 58 , 59 ]. MSG sequences have also been reported from two additional presumptive Pneumocystis species (one from ferrets and one from a macaque) that do not yet have their own species name [ 60 , 61 ].…”

Section: Introductionmentioning

confidence: 99%

Complexity of the MSG gene family of Pneumocystis carinii

Keely

Stringer

2009

BMC Genomics

View full text Add to dashboard Cite

Background: The relationship between the parasitic fungus Pneumocystis carinii and its host, the laboratory rat, presumably involves features that allow the fungus to circumvent attacks by the immune system. It is hypothesized that the major surface glycoprotein (MSG) gene family endows Pneumocystis with the capacity to vary its surface. This gene family is comprised of approximately 80 genes, which each are approximately 3 kb long. Expression of the MSG gene family is regulated by a cis-dependent mechanism that involves a unique telomeric site in the genome called the expression site. Only the MSG gene adjacent to the expression site is represented by messenger RNA. Several P. carinii MSG genes have been sequenced, which showed that genes in the family can encode distinct isoforms of MSG. The vast majority of family members have not been characterized at the sequence level.

show abstract

Pneumocystis murina MSG gene family and the structure of the locus associated with its transcription

Cited by 14 publications

References 91 publications

Assembly and Annotation of Pneumocystis jirovecii from the Human Lung Microbiome

Assembly and Annotation of Pneumocystis jirovecii from the Human Lung Microbiome

Functional Differentiation of tbf1 Orthologues in Fission and Budding Yeasts

Complexity of the MSG gene family of Pneumocystis carinii

Contact Info

Product

Resources

About