Pneumococcal 6-Phospho-β-Glucosidase (BglA3) Is Involved in Virulence and Nutrient Metabolism

Abstract

For the generation of energy, the important human pathogen Streptococcus pneumoniae relies on host-derived sugars, including ␤-glucoside analogs. The catabolism of these nutrients involves the action of 6-phospho-␤-glucosidase to convert them into usable monosaccharaides. In this study, we characterized a 6-phospho-␤-glucosidase (BglA3) encoded by SPD_0247. We found that this enzyme has a cell membrane localization and is active only against a phosphorylated substrate. A mutated pneumococcal ⌬SPD0247 strain had reduced 6-phospho-glucosidase activity and was attenuated in growth on cellobiose and hyaluronic acid compared to the growth of wild-type D39. ⌬SPD0247-infected mice survived significantly longer than the wild-type-infected cohort, and the colony counts of the mutant were lower than those of the wild type in the lungs. The expression of SPD_0247 in S. pneumoniae harvested from infected tissues was significantly increased relative to its expression in vitro on glucose. Additionally, ⌬SPD0247 is severely impaired in its attachment to an abiotic surface. These results indicate the importance of ␤-glucoside metabolism in pneumococcal survival and virulence. Streptococcus pneumoniae is a frequent occupant of the human nasopharynx, where it resides without causing symptoms (1). Conversely, the bacterium also is a major human pathogen, being a leading cause of bacterial pneumonia, otitis media, meningitis, and septicemia (1). The increasing trend of antibiotic resistance and the shortcomings of existing vaccines mean that a better understanding of the pathogenesis of pneumococcal diseases is required.Almost one-third of the transporters in the pneumococcal genome are dedicated to sugars (2), stressing the important role that these carbon sources play in the ability of pneumococci to survive in the host. The pneumococcus has been shown to ferment 32 different sugars in vitro, including various hexoses, ␣-and ␤-galactosides, and glucosides, as well as polysaccharides (3, 4). However, the concentrations of readily available simple carbohydrates in the respiratory tract are low (5); thus, the pneumococcus relies on complex host glycans for growth in vivo (4). Central to this is the ability to sequentially deglycosylate host glycoproteins (6).Mammalian extracellular matrix is rich in glycosaminoglycans (GAGs; e.g., hyaluronic acid), which contain ␤-linked disaccharide repeating units (7,8). The degradation of GAGs leads to the generation of structural analogues of cellobiose or N,N=-diacetylchitobiose [(GlcNAc) 2 ] and other ␤-linked disaccharides (9). Disaccharides such as these can be transported into the bacterial cell through phosphoenolpyruvate-dependent phosphotransferase systems (PTS), which transport and phosphorylate sugars simultaneously (10). The phosphorylated disaccharides then are hydrolyzed by cytoplasmic phospho-␤-glucosidases (EC 3.2.1.86) or phospho-␤-galactosidases (EC 3.2.1.85) that usually do not have hydrolytic activity toward nonphosphorylated substrates. The resulting glucose and glucose 6-pho...

Deacetylation of sialic acid by esterases potentiates pneumococcal neuraminidase activity for mucin utilization, colonization and virulence

“…This microbe is a commensal of the nasopharyngeal microbiota but it also causes serious life-threatening infections with a high morbidity and mortality, such as meningitis, bacteraemia, and pneumonia [ 6 , 7 ]. The pneumococcus encounters glycosylated host molecules both during colonization and infection of various tissues, and these molecules are very relevant for pneumococcal in vivo survival, attachment, and invasiveness [ 4 , 8 – 10 ]. Therefore, a detailed understanding of pneumococcal interaction with host glycoconjugates can offer strategies to combat this pathogen.…”

The Pneumococcal Surface Proteins PspA and PspC Sequester Host C4-Binding Protein To Inactivate Complement C4b on the Bacterial Surface

“…Construction of pspA and pspA pspC mutant strains. In vitro mariner mutagenesis was used to construct the pspA mutant (46). The genetic region containing SPD_0126 was amplified using SPD0126F (CAAGTCTAGCCAGCGTCGCT) and SPD0126R (CAGAATCAGCCCCTCCAAG) primers.…”

“…For this, 200 ng of PCR fragment was mixed with 200 to 400 ng of donor mariner plasmid pR412, conferring resistance to spectinomycin. The mixture was incubated in the presence of Himar1 transposase, as described previously (46,47). Gaps in transposition products were repaired with T4 DNA polymerase (New England BioLabs, Hitchin, UK) and subsequently by E. coli ligase (New England Biolabs).…”

Activation of invariant natural killer T cells stimulated with microbial α-mannosyl glycolipids

“…Infection of mice with S . pneumoniae was performed as previously described 46 , 47 . Ten-week-old female MF1 outbred mice (Charles River, Margate, UK) were lightly anesthetized with 3% (v/v) isoflurane over oxygen, and administered intranasally with an inoculum of 50 μl containing approximately 1 × 10 6 CFU in PBS (pH 7.0).…”