Platelet‐poor plasma stimulates the proliferation but inhibits the differentiation of rat osteoblastic cells <i>in vitro</i>

Hamdan, Ahmad A.; Loty, Sabine; Isaac, Juliane; Bouchard, Philippe; Berdal, Ariane; Sautier, Jean-Michel

doi:10.1111/j.1600-0501.2008.01687.x

Cited by 20 publications

(17 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Quantitative real‐time RT‐PCR was performed in triplicate using 1 µL cDNA, obtained as above indicated and specific primers for ALP (Fw5′ AGCCCTTCACTGCCATCCTGT 3′; Rw5′ ATTCTCTCGTTCACCGCCCAC 3′) and Runx‐2 (Fw: 5′GGACGAGGCAAGAGTTTCAC; Rw 5′ TGCCTGCCTGGGGTCTGTAA). Quantifast‐SYBR® Green PCR Kit (Qiagen SpA, Milan, Italy) was used according to the manufacturer's instructions and qPCR performed using Rotor Gene 6000 (Corbett).…”

Section: Methodsmentioning

confidence: 99%

Trabecular titanium can inducein vitroosteogenic differentiation of human adipose derived stem cells without osteogenic factors

Benazzo

Botta

Scaffino

et al. 2013

J Biomedical Materials Res

View full text Add to dashboard Cite

Trabecular Titanium (TT) is an innovative highly porous structure that imitates the morphology of trabecular bone with good mechanical properties. Adipose-derived stem cells are a multipotent cell population that can be used in regenerative medicine, in particular, for bone therapeutic applications. The ability of TT to induce the osteogenic differentiation of human adipose derived stem cells (hASCs) in the absence of osteogenic factors was evaluated using molecular biological, biochemical, and immunohistochemical methods. At 7 and 21 days from differentiation, the hASCs grown on TT scaffolds showed similar expressions of alkaline phosphatase (ALP) and Runx-2 both in the presence and in the absence of osteogenic factors, as well as at transcript and protein levels. hASCs cultured on monolayer in the presence of the medium obtained from the wells where hASCs/scaffold constructs were cultured in the absence of osteogenic factors differentiated towards the osteogenic phenotype: their gene and protein expression of ALP and Runx-2 was similar to that of the same cells cultured in the presence of osteogenic factors, and significantly higher than that of the ones cultured in growth medium.

show abstract

Section: Methodsmentioning

confidence: 99%

Trabecular titanium can inducein vitroosteogenic differentiation of human adipose derived stem cells without osteogenic factors

Benazzo

Botta

Scaffino

et al. 2013

J Biomedical Materials Res

View full text Add to dashboard Cite

show abstract

“…In addition, mixing PRF with b-TCP favors neoangiogenesis and capture of stem cells, and induces the migration of osteoprogenitor cells to the center of the graft, which subsequently leads to the formation of osteoblast cells inside the mixture (graft material) and finally the formation of new bone (regeneration) at a faster rate compared with the use of b-TCP without PRF [24,25]. Use of this mixture allows for implant placement after 4 months, which is an interval also needed by normal bone for new bone formation and regeneration but without donor site morbidity.…”

Section: Discussionmentioning

confidence: 99%

Is the mixture of β-tricalcium phosphate with platelet-rich fibrin quite enough for sinus lift and dental implant installation?

Mohandes¹

2014

Egyptian Journal of Oral & Maxillofacial Surgery

View full text Add to dashboard Cite

“…20 The use of disintegrations per minute provides a measure of actively replicating DNA within each individual cell; in this way, a higher number of disintegrations per minute correlates to increased cell number. 21 Radioactive thymidine is incorporated into the DNA of dividing cells.…”

Section: Patientsmentioning

confidence: 99%

Effects of Repetitive Platelet-rich Plasma Application on Human Tenocyte Proliferation

Mazzocca

O'Malley²,

Beitzel³

et al. 2015

Orthopedics

View full text Add to dashboard Cite

Current clinical application of platelet-rich plasma is showing a trend toward multiple treatments. The goal of this study was to show the benefit of interval platelet-rich plasma application in the healing and recovery of human tenocytes using an in vitro cell model. Eight volunteers (6 men and 2 women) were included in this study (mean±SD age, 31.6±10.9 years). Venous blood was collected from new blood draws at 3 different times. Two blood products were prepared on each day of treatment: platelet-rich plasma derived from a single-spin process (PRPSS) and platelet-rich plasma derived from a double-spin process (PRPDS). The study had 2 limbs: 2-day and 4-day intervals. Cell proliferation, measured as disintegrations per minute, was then examined via a radioactive thymidine assay. In the 2-day-interval group, the difference in disintegrations per minute between days 0 and 2 in the PRPSS group reached statistical significance (P =.006). In the PRPDS group, statistical difference was seen between days 0 and 4 (P=.001) and between days 2 and 4 (P=.030). In the 4-day-interval group, the difference in disintegrations per minute between days 4 and 8 in the PRPSS group reached statistical significance, showing a decrease in cell proliferation (P =.013). In the PRPDS group, a statistical difference was seen between days 0 and 8 (P=.021), also showing a decrease in cell proliferation. The greatest effect of platelet-rich plasma, which has a positive effect on tenocyte proliferation and recovery, is seen on initial application. Its effect is diminished with repetitive application, and this finding leads to questioning of the efficacy of interval platelet-rich plasma dosing.

show abstract

Platelet‐poor plasma stimulates the proliferation but inhibits the differentiation of rat osteoblastic cells in vitro

Abstract: These results suggest that, in the presence of homologous PPP, rat osteoblastic cells are able to maintain their phenotype, with a higher rate of proliferation. However, PPP seems to inhibit osteoblastic differentiation.

Cited by 20 publications

References 54 publications

Trabecular titanium can inducein vitroosteogenic differentiation of human adipose derived stem cells without osteogenic factors

Trabecular titanium can inducein vitroosteogenic differentiation of human adipose derived stem cells without osteogenic factors

Is the mixture of β-tricalcium phosphate with platelet-rich fibrin quite enough for sinus lift and dental implant installation?

Effects of Repetitive Platelet-rich Plasma Application on Human Tenocyte Proliferation

Contact Info

Product

Resources

About