Plasmodium vivax merozoite surface proteins-3β and-3γ share structural similarities with P. vivax merozoite surface protein-3α and define a new gene family

Galinski, Mary R.; Ingravallo, Paul; Corredor-Medina, Claudia; Al-Khedery, Basima; Póvoa, Marinete Marins; Barnwell, John W.

doi:10.1016/s0166-6851(01)00267-5

Cited by 62 publications

(83 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Based on published PvMSP3β sequences (Galinski et al, 2001;Rayner et al, 2004) and those obtained from 58 Thai isolates (Cui, unpublished), we designed primers from the conserved sequences to amplify the 5′ region of the gene containing most of the insertions/deletions. Primary PCR of PvMSP3β was performed in 20 μl using 3 μl of DNA using primers F1 (5′ GGTATTCTTCGCAACACTC 3′) and R1 (5′ GCTTCTGATGTTATTTCCAG 3′).…”

Section: Pcr Of Pvmsp3β Genesmentioning

confidence: 99%

“…Comparing the 16 published PvMSP3β sequences (Galinski et al, 2001;Rayner et al, 2004) and those obtained from 58 Thai P. vivax isolates, we designed conserved primers for nested PCR amplifications of the 5′ region of this gene, which corresponds to nucleotide positions 81-1515 of the Belem strain (Fig. 1).…”

Section: Size Polymorphism Of Pvmsp3β and Rflp Analysismentioning

confidence: 99%

See 1 more Smart Citation

Genetic structures of geographically distinct Plasmodium vivax populations assessed by PCR/RFLP analysis of the merozoite surface protein 3β gene

et al. 2006

View full text Add to dashboard Cite

The recent resurgence of Plasmodium vivax malaria requires close epidemiological surveillance and monitoring of the circulating parasite populations. In this study, we developed a combination of polymerase chain reaction and restriction fragment length polymorphism (PCR/RFLP) method to investigate the genetic diversity of the P. vivax merozoite surface protein 3β (PvMSP3β) gene among four Asian parasite populations representing both tropical and temperate strains with dramatic divergent relapse patterns (N = 143). Using P. vivax field isolates from symptomatic patients, we have validated the feasibility of this protocol in distinguishing parasite genotypes. We have shown that PCR alone could detect three major size polymorphisms of the PvMSP3β gene, and restriction analysis detected a total of 12 alleles within these Asian samples. Samples from different geographical areas differed dramatically in their PvMSP3β allele composition and frequency, indicating that complex, yet different parasite genotypes were circulating in different endemic areas. This protocol allowed easy detections of multiple infections, which reached 20.5% in the samples from Thailand. It is interesting to note that samples from one temperate site in China collected during a recent outbreak of the disease also showed a high level of genetic diversity with multiple infections accounting for 5.6% of the samples. When combined with the PvMSP3α locus, this method provides better capability in distinguishing P. vivax genotypes and detecting mixed genotype infections.

show abstract

Section: Pcr Of Pvmsp3β Genesmentioning

confidence: 99%

Section: Size Polymorphism Of Pvmsp3β and Rflp Analysismentioning

confidence: 99%

Genetic structures of geographically distinct Plasmodium vivax populations assessed by PCR/RFLP analysis of the merozoite surface protein 3β gene

et al. 2006

View full text Add to dashboard Cite

show abstract

“…Of the~5,500 genes encoded by the P. vivax genome, 20 few have been studied as potential vaccine candidate antigens, and none of these genes are liver stagespecific genes. [22][23][24][25][26][27][28][29][30] Nevertheless, studies in P. falciparum suggest that the breadth and magnitude of the antibody responses to parasite antigens determine the level of protection, 31,32 highlighting the need to fully characterize the natural antibody response after P. vivax exposure to develop an effective anti-infection and anti-disease vaccine. Therefore, in this study, we used an advanced high-throughput screening technology [33][34][35][36][37] to identify novel P. vivax pre-erythrocyticstage antigens in populations living in malaria-endemic areas of Colombia.…”

Section: Introductionmentioning

confidence: 99%

Plasmodium vivax Pre-Erythrocytic–Stage Antigen Discovery: Exploiting Naturally Acquired Humoral Responses

Molina

Finney

Arévalo‐Herrera³

et al. 2012

The American Society of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Abstract. The development of pre-erythrocytic Plasmodium vivax vaccines is hindered by the lack of in vitro culture systems or experimental rodent models. To help bypass these roadblocks, we exploited the fact that naturally exposed Fy− individuals who lack the Duffy blood antigen (Fy) receptor are less likely to develop blood-stage infections; therefore, they preferentially develop immune responses to pre-erythrocytic-stage parasites, whereas Fy+ individuals experience both liver-and blood-stage infections and develop immune responses to both pre-erythrocytic and erythrocytic parasites. We screened 60 endemic sera from P. vivax-exposed Fy+ or Fy− donors against a protein microarray containing 91 P. vivax proteins with P. falciparum orthologs that were up-regulated in sporozoites. Antibodies against 10 P. vivax antigens were identified in sera from P. vivax-exposed individuals but not unexposed controls. This technology has promising implications in the discovery of potential vaccine candidates against P. vivax malaria.

show abstract

“…2,3 PvMSP-3α has a large central domain with 20-30% alanine residues, which occupies the first and fourth positions of the typical heptad repeat unit. 4,5 These heptad repeat units are predicted to form coiled alphahelical structures that may facilitate anchoring the proteins to the merozoite surface. 2,4,6 Globally, three major alleles of the PvMSP-3α gene are known to be widely distributed; their sizes are approximately 1.5, 2.1, and 2.4 kb.…”

mentioning

confidence: 99%

Emergence of New Alleles of the MSP-3α Gene in Plasmodium vivax Isolates from Korea

Nam

Oh²,

Nam³

et al. 2010

The American Society of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Abstract. Nucleotide sequence analysis of the Plasmodium vivax PvMSP-3α gene was conducted on blood from 143 malaria patients admitted to Korea University Medical Center from 1996 to 2007 in the Republic of Korea (ROK). From 1996 to 2002, the PvMSP-3α alleles were of two types, SKOR-67 (2.53 kb) and SKOR-69 (1.78 kb), which differed in length and amino acid sequence. Two new variants with similar size to SKOR-67 were first observed in 2002 and in 2006-2007 accounted for nearly 50% (25/51) of the sampled isolates. The new variants had the same amino acid sequence as SKOR-69 in the N-terminal region, but in Blocks I and II and in the C-terminal region, they were similar to previously reported isolates from Thailand, Papua New Guinea, India, Brazil, and Ecuador strains.

show abstract

Plasmodium vivax merozoite surface proteins-3β and-3γ share structural similarities with P. vivax merozoite surface protein-3α and define a new gene family

Cited by 62 publications

References 54 publications

Genetic structures of geographically distinct Plasmodium vivax populations assessed by PCR/RFLP analysis of the merozoite surface protein 3β gene

Genetic structures of geographically distinct Plasmodium vivax populations assessed by PCR/RFLP analysis of the merozoite surface protein 3β gene

Plasmodium vivax Pre-Erythrocytic–Stage Antigen Discovery: Exploiting Naturally Acquired Humoral Responses

Emergence of New Alleles of the MSP-3α Gene in Plasmodium vivax Isolates from Korea

Contact Info

Product

Resources

About