Plasmodium falciparum Na+/H+ Exchanger (pfnhe-1) Genetic Polymorphism in Indian Ocean Malaria-Endemic Areas

Abstract

Abstract. To date, 11 studies conducted in different countries to test the association between Plasmodium falciparum Na + /H + exchanger gene ( pfnhe-1; PF13_0019) polymorphisms and in vitro susceptibility to quinine have generated conflicting data. In this context and to extend our knowledge of the genetic polymorphism of Pfnhe gene, we have sequenced the ms4760 locus from 595 isolates collected in the Comoros (N = 250; an area with a high prevalence of chloroquine and sulfadoxine-pyrimethamine resistance) and Madagascar (N = 345; a low drug-resistance area). Among them, 29 different alleles were observed, including 8 (27%) alleles not previously described. Isolates from the Comoros showed more repeats in block II (DNNND), which some studies have found to be positively associated with in vitro resistance to quinine, compared with isolates from Madagascar. Additional studies are required to better define the mechanisms underlying quinine resistance, which involve multiple gene interactions.Quinine (QN), a natural quinoline derivative compound found in Cinchona bark, has been used for centuries in malaria-endemic regions.1 To date, resistance to QN remains particularly patchy and rare, 2-12 and only few cases of clinical failure have been reported in Asia and South America. The mechanism underlying QN resistance is not well-understood, and it is probably complex and multigenic. Since the seminal work by Ferdig and others 13 in 2004, 11 studies have been conducted in different countries to evaluate implication of ms4760 polymorphisms in QN resistance, [14][15][16][17][18][19][20][21][22][23][24] and conflicting data have been reported, likely because of the different geographical origin of parasites (implying different genetic backgrounds), the type of parasites used (fresh isolates, culture-adapted strains, and reference lines), and the method used to assess in vitro QN susceptibility. 21,25 In this context and to extend our previous work regarding ms4760 polymorphisms in Plasmodium falciparum parasites circulating in malaria-endemic areas in the Indian Ocean, Parasite DNA was extracted from blood spots with Instagene matrix (Bio-Rad, Marnes la Coquette, France) according to the manufacturer's instructions or directly from 100 μL infected blood by the phenol-chloroform method. 26The parasite species was confirmed by real-time polymerase chain reaction (PCR) as described in the work by Mangold and others.27 Amplification and sequencing of the ms4760 locus in the P. falciparum Na + /H + exchanger gene (pfnhe-1) was performed in accordance with the protocol described earlier.14 pfnhe-1 ms4760 alleles were constructed from a full sequence presenting an unambiguous single-allele signal at all positions and used P. falciparum 3D7 (sodium/hydrogen exchanger, Na + , H + antiporter, PF13_0019, XM_001349726) as the reference.Genetic diversity was assessed by Nei's unbiased expected heterozygosity (H e ) from haploid data and calculated as H e = [n/(n -1)][1 − p i ] (n = the number of isolates sampled; p i = the frequency o...

In vitro susceptibility to quinine and microsatellite variations of the Plasmodium falciparum Na+/H+ exchanger transporter (Pfnhe-1) gene in 393 isolates from Dakar, Senegal

“…Among the 393 studied sequences, 47 different alleles were observed in samples from Dakar. Consistent with previous reports [22,24,40], Pfnhe-1  ms4760 was highly diverse among parasite isolates. It appears that polymorphisms are more important in Africa and the Indian Ocean region than in India or Asia: in Senegal, 47 different profiles (393 samples) were observed; in the Republic of Congo, 27 different profiles (74 samples) [24]; in Uganda, 40 different profiles (172 samples) [22]; and in the Indian Ocean, 29 different profiles (595 samples) [40], whereas in Vietnam, only ten different profiles (79 samples) were observed [18]; in the China-Myanmar border area, ten different profiles (60 samples) [19]; and…”

“…This situation likely reflects the level of transmission in these areas and the level of QN selection pressure. The genetic diversity of ms4760, assessed by Nei’s unbiased expected heterozygosity (He), was significantly higher in African isolates (ranged from 0.66 to 0.85) and Indian isolates (0.68) than in Asian isolates (0.49 to 0.68) [40]. Only three profiles (ms4760-1, ms4760-3 and ms4760-7) of the four expected predominant profiles (ms4760-1, ms4760-3, ms4760-6 and ms4760-7) [18-24,40,41] were found to predominate in Senegal.…”

Genome Analysis Using Whole-Exome Sequencing of Non-Syndromic Cleft Lip and/or Palate from Malagasy Trios Identifies Variants Associated with Cilium-Related Pathways and Asian Genetic Ancestry

“…Additionally, it has been found that 78% of all GWAS studies are of European ancestry, with only 2% African representation and 8% East Asian representation [ 28 ]. Only 19 genetic-focused studies have been conducted that included Malagasy populations [ 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 , 45 ]. Most of these studies utilize genetic techniques to investigate the genetic lineages of Malagasy populations, whose ancestral history has been widely disputed.…”

Population-level genome-wide STR discovery and validation for population structure and genetic diversity assessment of Plasmodium species

“…trinucleotide or hexanucleotide repeats) will not result in a frame-shift mutation when repeats are deleted or added, but can change protein sequences [10]. For example, the Pfnhe-1 protein contains a polymorphic amino acid motif DNNND (GATAACAATAATGAT) and DDNHNDNHNND (GATGATAACCATAATGATAATCATAATAATGAT) which affects the P. falciparum Na+/H+ exchanger capabilities, and influences quinine resistance by combining Pfcrt and Pfmdr1 [11,12].…”