Plasmid pKpQIL encoding KPC-3 and TEM-1 confers carbapenem resistance in an extremely drug-resistant epidemic Klebsiella pneumoniae strain

Leavitt, Azita; Chmelnitsky, Inna; Ofek, Itzhak; Carmeli, Yehuda; Navon-Venezia, Shiri

doi:10.1093/jac/dkp417

Cited by 85 publications

(87 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Members of the pKpQIL plasmid family have been responsible globally for a number of CRE outbreaks (3,5,7,31,(33)(34)(35)(36). In pKpQIL and related plasmids, the bla KPC gene is located within a Tn4401 transposon sequence (4,37,38).…”

Section: Discussionmentioning

confidence: 99%

“…Hospital CRE outbreaks often involve patient-to-patient transmission of genetically clonal populations of resistant bacteria. In particular, Klebsiella pneumoniae sequence type 258 (ST258) and its derivatives carrying plasmid-borne bla KPC carbapenemase genes have spread to cause outbreaks globally (3)(4)(5)(6)(7)(8)(9)(10). Some evidence suggests that CRE outbreaks could alternatively involve the primary transmission of carbapenemase-encoding plasmids or other mobile elements among genetically heterogeneous populations of bacteria, although this has not been demonstrated to be a dominant epidemiologic mechanism to date (11)(12)(13)(14)(15)(16)(17)(18).…”

mentioning

confidence: 99%

See 1 more Smart Citation

A Rapid Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Method for Single-Plasmid Tracking in an Outbreak of Carbapenem-Resistant Enterobacteriaceae

et al. 2014

View full text Add to dashboard Cite

e Carbapenem-resistant Enterobacteriaceae (CRE) have spread globally and represent a serious and growing threat to public health. Rapid methods for tracking plasmids carrying carbapenemase genes could greatly benefit infection control efforts. Here, we demonstrate that real-time, direct tracking of a single plasmid in a bacterial strain responsible for an outbreak is possible using a commercial matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) system. In this case, we retrospectively tracked the bla KPC carbapenemase gene-bearing pKpQIL plasmid responsible for a CRE outbreak that occurred at the NIH Clinical Center in 2011. An ϳ11,109-Da MS peak corresponding to a gene product of the bla KPC pKpQIL plasmid was identified and characterized using a combination of proteomics and molecular techniques. This plasmid peak was present in spectra from retrospectively analyzed K. pneumoniae outbreak isolates, concordant with results from whole-genome sequencing, and absent from a diverse control set of bla KPC -negative clinical Enterobacteriaceae isolates. Notably, the gene characterized here is located adjacent to the bla KPC Tn4401 transposon on the pKpQIL plasmid. Sequence analysis demonstrates the presence of this gene in other bla KPC Tn4401-containing plasmids and suggests that this signature MS peak may be useful in tracking other plasmids conferring carbapenem resistance. Plasmid identification using this MALDI-TOF MS method was accomplished in as little as 10 min from isolated colonies and 30 min from positive (spiked) blood cultures, demonstrating the potential clinical utility for real-time plasmid tracking in an outbreak.

show abstract

Section: Discussionmentioning

confidence: 99%

mentioning

confidence: 99%

A Rapid Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Method for Single-Plasmid Tracking in an Outbreak of Carbapenem-Resistant Enterobacteriaceae

et al. 2014

View full text Add to dashboard Cite

show abstract

“…All representative plasmids (according to size) were gel extracted as previously described (42) for further individual analysis. To determine whether pKpQIL, the bla KPC -harboring plasmid (29,31), was modified or absent, three genetic elements of this plasmid were screened by PCR: the repA gene (8), the truncated bla OXA-9 gene (F= primer, GCTGCATATGTTGGTGTTCG; R= primer, TTGCTCCTTGGGAGATATGG), and the Tn4401 transposon, tested at an internal region (F= primer, TCTCCAGCACCCACTGTCTG; R= primer, TGCCGTGATGAAGCGTGT) and at its flanking regions as previously described (10).…”

Section: Methodsmentioning

confidence: 99%

A Swordless Knight: Epidemiology and Molecular Characteristics of the bla _KPC -Negative Sequence Type 258 Klebsiella pneumoniae Clone

et al. 2012

View full text Add to dashboard Cite

cIn June 2010, a bla KPC -negative, ertapenem-resistant ST-258 Klebsiella pneumoniae strain was isolated from a patient in the Laniado Medical Center (LMC). Our aims were (i) to describe its molecular characteristics and resistance mechanisms and (ii) to assess whether the bla KPC -negative ST-258 K. pneumoniae clone spreads as efficiently as its KPC-producing isogenic strain. In a prospective study, surveillance of all ertapenem-resistant, carbapenemase-negative K. pneumoniae (

show abstract

“…pKpQIL-like plasmids from the New York and New Jersey isolates were associated mostly with bla KPC-2 and to a lesser extent with bla KPC-3 , whereas the pKpQIL plasmids from Israel were associated mainly with bla (194,195). This suggests that ST258 isolates with bla KPC-3 on pKpQIL plasmids were introduced into Israel from the United States during the mid-2000s (a founder effect), followed by clonal expansion in Israel.…”

Section: Plasmids Associated With K Pneumoniae St258mentioning

confidence: 99%

The Role of Epidemic Resistance Plasmids and International High-Risk Clones in the Spread of Multidrug-Resistant Enterobacteriaceae

2015

View full text Add to dashboard Cite

SUMMARY Escherichia coli sequence type 131 (ST131) and Klebsiella pneumoniae ST258 emerged in the 2000s as important human pathogens, have spread extensively throughout the world, and are responsible for the rapid increase in antimicrobial resistance among E. coli and K. pneumoniae strains, respectively. E. coli ST131 causes extraintestinal infections and is often fluoroquinolone resistant and associated with extended-spectrum β-lactamase production, especially CTX-M-15. K. pneumoniae ST258 causes urinary and respiratory tract infections and is associated with carbapenemases, most often KPC-2 and KPC-3. The most prevalent lineage within ST131 is named fimH30 because it contains the H30 variant of the type 1 fimbrial adhesin gene, and recent molecular studies have demonstrated that this lineage emerged in the early 2000s and was then followed by the rapid expansion of its sublineages H30-R and H30-Rx. K. pneumoniae ST258 comprises 2 distinct lineages, namely clade I and clade II. Moreover, it seems that ST258 is a hybrid clone that was created by a large recombination event between ST11 and ST442. Epidemic plasmids with bla CTX-M and bla KPC belonging to incompatibility group F have contributed significantly to the success of these clones. E. coli ST131 and K. pneumoniae ST258 are the quintessential examples of international multidrug-resistant high-risk clones.

show abstract

Plasmid pKpQIL encoding KPC-3 and TEM-1 confers carbapenem resistance in an extremely drug-resistant epidemic Klebsiella pneumoniae strain

Cited by 85 publications

References 15 publications

A Rapid Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Method for Single-Plasmid Tracking in an Outbreak of Carbapenem-Resistant Enterobacteriaceae

A Rapid Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Method for Single-Plasmid Tracking in an Outbreak of Carbapenem-Resistant Enterobacteriaceae

A Swordless Knight: Epidemiology and Molecular Characteristics of the bla _KPC -Negative Sequence Type 258 Klebsiella pneumoniae Clone

The Role of Epidemic Resistance Plasmids and International High-Risk Clones in the Spread of Multidrug-Resistant Enterobacteriaceae

Contact Info

Product

Resources

About

Plasmid pKpQIL encoding KPC-3 and TEM-1 confers carbapenem resistance in an extremely drug-resistant epidemic Klebsiella pneumoniae strain

Cited by 85 publications

References 15 publications

A Rapid Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Method for Single-Plasmid Tracking in an Outbreak of Carbapenem-Resistant Enterobacteriaceae

A Rapid Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Method for Single-Plasmid Tracking in an Outbreak of Carbapenem-Resistant Enterobacteriaceae

A Swordless Knight: Epidemiology and Molecular Characteristics of the bla KPC -Negative Sequence Type 258 Klebsiella pneumoniae Clone

The Role of Epidemic Resistance Plasmids and International High-Risk Clones in the Spread of Multidrug-Resistant Enterobacteriaceae

Contact Info

Product

Resources

About

A Swordless Knight: Epidemiology and Molecular Characteristics of the bla _KPC -Negative Sequence Type 258 Klebsiella pneumoniae Clone