Plasmid diversity in arctic strains of Psychrobacter spp.

Abstract

Six strains of Psychrobacter spp. isolated from guano of little auks collected on Spitsbergen island (Arctic) carried nine plasmids that were fully sequenced. These replicons (ranging in size from 2917 to 14924 bp) contained either repA (ColE2-type) or repB (iteron-type) replication systems of a relatively narrow host range, limited to Psychrobacter spp. All but one of the plasmids carried predicted mobilization for conjugal transfer systems, encoding relaxases of the MOBQ, MOBV or MOBP families. The plasmids also contained diverse additional genetic load, including a type II restriction-modification system and a gene encoding a putative subunit C of alkyl hydroperoxide reductase (AhpC)—an antioxidant enzyme and major scavenger of reactive oxygen species. Detailed comparative sequence analyses, extended to all plasmids identified so far in psychrophilic bacteria, distinguished groups of the most ubiquitous replicons, which play a key role in horizontal gene transfer in cold environments.Electronic supplementary materialThe online version of this article (doi:10.1007/s00792-013-0521-0) contains supplementary material, which is available to authorized users.

Genome-based insights into the resistome and mobilome of multidrug-resistant Aeromonas sp. ARM81 isolated from wastewater

“…(Maj et al 2013) or Psychrobacter spp. (Dziewit et al 2013)] or belonging to a particular incompatibility group [e.g., IncL/M plasmids (Adamczuk et al 2015)], which supports the hypothesis that there is a clear distinction between the permanent members (genes) constituting plasmid backbones and the operative genes (additional load) that can be exchanged between replicating elements in the cell and are not conserved elements of plasmids (Norman et al 2009). …”

Microbiological changes, shelf life and identification of initial and spoilage microbiota of sea bream fillets stored under various conditions using 16S rRNA gene analysis

“…A colony polymerase chain reaction (PCR) method was employed for the amplification of 16S rRNA gene fragments using bacterial cells directly as the template . Approximately 900 bp of 16S rRNA gene was amplified by PCR with universal primers 27f BAC (5′‐AGAGTTTGATCMTGGCTCAG‐3′; M = A/C) and 907r BAC (5′‐CCCGTCAATTCCTTTGAGTTT‐3′) on a thermal cycler (MyCycler, Bio‐Rad, Hercules, CA, USA).…”

“…7,28 Identification of microbiota A colony polymerase chain reaction (PCR) method was employed for the amplification of 16S rRNA gene fragments using bacterial cells directly as the template. 29 Approximately 900 bp of 16S rRNA gene was amplified by PCR with universal primers 27f BAC (5 ′ -AGAGTTTGATCMTGGCTCAG-3 ′ ; M = A/C) 30 and 907r BAC (5 ′ -CCCGTCAATTCCTTTGAGTTT-3 ′ ) 31 on a thermal cycler (MyCycler, Bio-Rad, Hercules, CA, USA). For direct PCR amplification, the PCR mixture (20 μL final volume) consisted of 4 μL of 5× buffer (Green GoTaq Flexi buffer, Promega, Madison, WI, USA), 2 μL of dNTPs (2 mmol L −1 ), 1.2 μL of MgCl 2 (25 mmol L −1 ), 0.1 μL of each primer and 0.1 μL of Taq polymerase (GoTaq DNA polymerase, Promega).…”

Novel Replication-Competent Circular DNA Molecules from Healthy Cattle Serum and Milk and Multiple Sclerosis-Affected Human Brain Tissue

“…The alignment of this repeat region indicates a variation in the core of single nucleotides. These iteron-like repeats may constitute the binding sites for Rep proteins ( 4 , 5 ).…”