Pivotal Role of Bcl-2 Family Proteins in the Regulation of Chondrocyte Apoptosis

Abstract

During endochondral ossification, chondrocytes undergo hypertrophic differentiation and die by apoptosis. The level of inorganic phosphate (P i ) elevates at the site of cartilage mineralization, and when chondrocytes were treated with P i , they underwent rapid apoptosis. Gene silencing of the proapoptotic Bcl-2 homology 3-only molecule bnip3 significantly suppressed P i -induced apoptosis. Conversely, overexpression of Bcl-xL suppressed, and its knockdown promoted, the apoptosis of chondrocytes. Bnip3 was associated with Bcl-xL in chondrocytes stimulated with P i . Bcl-xL was expressed uniformly in the growth plate chondrocytes, whereas Bnip3 expression was exclusively localized in the hypertrophic chondrocytes. Finally, we generated chondrocyte-specific bcl-x knock-out mice using the Cre-loxP recombination system, and we provided evidence that the hypertrophic chondrocyte layer was shortened in those mice because of an increased apoptosis of prehypertrophic and hypertrophic chondrocytes, with the mice afflicted with dwarfism as a result. These results suggest the pivotal role of Bcl-2 family members in the regulation of chondrocyte apoptosis.Endochondral ossification is an essential process for skeletal development, fracture healing, and pathologic conditions such as osteoarthritis and ectopic ossification (1). In this process, chondrocytes first proliferate and then differentiate into mature hypertrophic chondrocytes, which mineralize the surrounding matrix that is finally replaced by bone (1). There is controversy as to the cell fate of hypertrophic chondrocytes, and several studies have shown that they undergo apoptosis after terminal differentiation (2-4). Apoptosis is a form of programmed cell death that is characterized by specific morphological and biochemical features, and is tightly regulated by extracellular stimuli and intracellular signaling pathways (5). Morphologically, apoptosis is characterized by a series of structural changes in dying cells as follows: blebbing of the plasma membrane, condensation of the cytoplasm and the nucleus, and cellular fragmentation into membrane apoptotic bodies. Biochemically, apoptosis is characterized by the degradation of chromatin, initially into large fragments of 50 -300 kb and subsequently into smaller fragments that are monomers and multimers of 200 bases. Not only does apoptosis regulate various aspects of the biological activity, but it also can trigger cancer, autoimmune diseases, and degenerative disorders (6). Several molecules such as Sox5, -6, and -9 and Runx2 have been reported to regulate proliferation and hypertrophic differentiation of chondrocytes (7-9). However, the physiologic and pathologic significance of chondrocyte apoptosis and key molecules that regulate this process remain to be elucidated. Previous studies have shown the possible involvement of cytokines, such as tumor necrosis factor-␣ and Fas ligand, and hormones, such as glucocorticoids and parathyroid hormonerelated peptide (PTHrP), 2 in the localized hypoxia and increased generati...

Phosphate-induced Apoptosis of Hypertrophic Chondrocytes Is Associated with a Decrease in Mitochondrial Membrane Potential and Is Dependent upon Erk1/2 Phosphorylation

“…In vivo investigations in genetically modified and dietary-manipulated mouse models demonstrate that hypophosphatemia is the underlying metabolic abnormality that impairs growth plate maturation in these disorders: low circulating phosphate levels result in impaired apoptosis of terminally differentiated hypertrophic chondrocytes in the growth plate, leading to rickets (2). The observation that inhibition of phosphate transport prevents phosphate-mediated apoptosis in hypertrophic chondrocytes (7)(8)(9) further reinforces that circulating phosphate, rather than the presence of local mineralized matrix, is a key determinant of hypertrophic chondrocyte apoptosis. In vitro investigations demonstrate that the mitochondrial apoptotic pathway is activated by phosphate, resulting in caspase-9 cleavage and induction of hypertrophic chondrocyte apoptosis.…”

“…Modulation of phosphate-induced apoptosis by Bcl family members also plays a critical role in the susceptibility of hypertrophic chondrocytes to this apoptotic stimulus. Mice with chondrocyte-specific ablation of the anti-apoptotic protein Bcl-x demonstrate growth retardation associated with reduction in the hypertrophic chondrocyte layer, which is postulated to be due to enhanced apoptosis of these cells (9). Although Bcl-x expression levels are not altered during chondrocyte differentiation, the expression of the pro-apoptotic protein Bnip3 increases with chondrocyte hypertrophy.…”

“…Although Bcl-x expression levels are not altered during chondrocyte differentiation, the expression of the pro-apoptotic protein Bnip3 increases with chondrocyte hypertrophy. Thus, the increase in expression of Bnip3 is thought to impair the anti-apoptotic function of Bcl-x in hypertrophic chondrocytes, contributing to their susceptibility to phosphate-mediated apoptosis (9).…”

Intracellular and Extracellular ATP Coordinately Regulate the Inverse Correlation between Osteoclast Survival and Bone Resorption

“…For gene silencing, an RNAi sequence was designed for the mouse Bcl-x L gene. The targeting sequence used was GCGTTCAGTGATCTAACATCC (22). The RNAi expression vector for this gene was constructed with piGENEmU6 vector (for mouse; iGENE Therapeutics).…”

Growth plate expression profiling: Large and small breed dogs provide new insights in endochondral bone formation

“…For example, of the genes up‐regulated in Great Danes compared with Miniature Poodles, the UCMA gene and the NK3 homeobox 2 ( Nkx3‐2 ) gene stimulate early chondrocyte differentiation,31, 32 and BCL2/adenovirus interacting protein 3 ( BNIP3 ) regulates chondrocyte apoptosis 33. This is consistent with the complex mechanisms underlying differences in height, which are probably associated with changes in the equilibrium between the various systemic and local factors that regulate the rate of endochondral bone formation.…”