Phytantriol-Based Berberine-Loaded Liquid Crystalline Nanoparticles Attenuate Inflammation and Oxidative Stress in Lipopolysaccharide-Induced RAW264.7 Macrophages

Abstract

Inflammation and oxidative stress are interrelated processes that represent the underlying causes of several chronic inflammatory diseases that include asthma, cystic fibrosis, chronic obstructive pulmonary disease (COPD), allergies, diabetes, and cardiovascular diseases. Macrophages are key initiators of inflammatory processes in the body. When triggered by a stimulus such as bacterial lipopolysaccharides (LPS), these cells secrete inflammatory cytokines namely TNF-α that orchestrate the cellular inflammatory process. Simultaneously, pro-inflammatory stimuli induce the upregulation of inducible nitric oxide synthase (iNOS) which catalyzes the generation of high levels of nitric oxide (NO). This, together with high concentrations of reactive oxygen species (ROS) produced by macrophages, mediate oxidative stress which, in turn, exacerbates inflammation in a feedback loop, resulting in the pathogenesis of several chronic inflammatory diseases. Berberine is a phytochemical embedded with potent in vitro anti-inflammatory and antioxidant properties, whose therapeutic application is hindered by poor solubility and bioavailability. For this reason, large doses of berberine need to be administered to achieve the desired pharmacological effect, which may result in toxicity. Encapsulation of such a drug in liquid crystalline nanoparticles (LCNs) represents a viable strategy to overcome these limitations. We encapsulated berberine in phytantriol-based LCNs (BP-LCNs) and tested the antioxidant and anti-inflammatory activities of BP-LCNs in vitro on LPS-induced mouse RAW264.7 macrophages. BP-LCNs showed potent anti-inflammatory and antioxidant activities, with significant reduction in the gene expressions of TNF-α and iNOS, followed by concomitant reduction of ROS and NO production at a concentration of 2.5 µM, which is lower than the concentration of free berberine concentration required to achieve similar effects as reported elsewhere. Furthermore, we provide evidence for the suitability for BP-LCNs both as an antioxidant and as an anti-inflammatory agent with potential application in the therapy of chronic inflammatory diseases.

Anti‐inflammatory, antioxidant, and immunomodulatory effects of Berberis vulgaris and its constituent berberine, experimental and clinical, a review

“…Berberine (16.8, 8.4, and 4.2 μM, for 24 h) prevented influenza virus‐induced Nod‐like receptor protein 3 (NLRP3) activation by promoting mitophagy and reducing mitochondrial oxidative stress in macrophages J774A.1 cells (Liu et al, 2020). Berberine in phytantriol‐based liquid crystalline nanoparticles (BP‐LCNs) (1.0 or 2.5 μM, for 24 h) inhibited ROS and NO production and reduced expressions of TNF‐α and iNOS in lipopolysaccharide‐induced RAW264.7 macrophages (Alnuqaydan et al, 2022). By modulating these molecular mechanisms, berberine can protect the macrophages from the detrimental effects of influenza virus and lipopolysaccharide, which are common pathogens that cause respiratory and systemic diseases.…”

Gallic Acid-Modified Polyethylenimine–Polypropylene Carbonate–Polyethylenimine Nanoparticles: Synthesis, Characterization, and Anti-Periodontitis Evaluation

“…Subsequently, real-time qPCR was carried out on 25 ng of cDNA using a QuantStudio 1 Plus Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) with GS AntiQ qPCR SYBR Green FAST MIX (Genesand Biotech Co, Beijing, China) and 0.5 μM of each of the forward and reverse primers for TNF-α, IL-6, IL-1β, and β-actin obtained from Sangon Biotech Co. (Shanghai, China). The primer sequences used were referenced to published studies and are detailed in Table S2. , …”

“…The primer sequences used were referenced to published studies and are detailed in Table S2 . 51 , 52 …”

“…The primer sequences used were referenced to published studies and are detailed in Table S2. 51,52 Statistical Analysis. The data for the anti-inflammatory array characterization were all presented as mean ± SEM.…”

Zerumbone-incorporated liquid crystalline nanoparticles inhibit proliferation and migration of non-small-cell lung cancer in vitro

“…The RNA purity and concentration was determined using Nanodrop One (Thermo Fisher Scientific). The RNA was reverse transcribed to synthesize cDNA and qPCR was performed to determine the mRNA levels of genes of interest (Alnuqaydan et al 2022 ). The forward and reverse primers for genes encoding tumor protein 53 ( P53 , forward: ACCTATGGAAACTACTTCCTG; reverse: ACCATTGTTCAATATCGTCC), phosphatase and tensin homolog ( PTEN , forward: GGCTAAGTGAAGATGACAATC; reverse: GTTACTCCCTTTTTGTCTCTG), keratin 18 ( KRT18 , forward: GGAAGTAAAAGGCCTACAAG; reverse: GTACTTGTCTAGCTCCTCTC), and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH , forward: TCGGAGTCAACGGATTTG; reverse: CAACAATATCCACTTTACCAGAG) were procured from Merck.…”