Phylogeny of Metarhizium: analysis of ribosomal DNA sequence data

Curran, James T.; Driver, Felice; Ballard, J. William O.; Milner, Richard

doi:10.1016/s0953-7562(09)80478-4

Cited by 148 publications

(74 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Our study also showed that M. a. anisopliae, M. album and M. flavoviride can be clearly differentiated using PCR-RFLP of the ITS 1-5.8S-ITS 2 region, supporting the view of Curran et al (1994) who used amplification and sequencing of the 5.8 S gene, intergenic regions ITS 1 and ITS 2 and phylogenetic analysis to show that M. anisopliae and M. flavoviride + M. album represent two separate evolutionary lines.…”

Section: Discussionsupporting

confidence: 84%

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Destéfano

Messias

2004

Genet. Mol. Biol.

View full text Add to dashboard Cite

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S-ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E 9 , B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E 9 , B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

show abstract

Section: Discussionsupporting

confidence: 84%

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Destéfano

Messias

2004

Genet. Mol. Biol.

View full text Add to dashboard Cite

show abstract

“…The conidiogenous cells have rounded to conical apices, and the conidia are aseptate, cylindrical to ovoid, and produced in a solid mass of parallel chains. Curran et al (1994) and Driver, Milner & Trueman (2000) revised the genus, including nrDNA sequence data, and found the level of intra-and interspecific nrDNA variation to be high. The apparent aberrant placement of Tolypocladium parasiticum in clade III, separated from the rest of the Tolypocladium taxa (clade IV), calls for a re-assessment of the diagnostic characters of this taxon.…”

Section: Discussionmentioning

confidence: 99%

“…In Cordyceps, several studies that also include associated mitosporic anamorphs have been made ; Rakotonirainy et al (1991) compared LSU rDNA sequences of Beauveria bassiana, Tolypocladium cylindrosporum, and T. extinguens and found the level of variation sufficient to discriminate among genera and species. In Metarhizium, the internal transcribed spacer (ITS) region of nrDNA resolved intra-and inter-species relationships, and efficiently demarcated the genus from the hyphomycete genera Beauveria and Paecilomyces (Curran et al 1994). Engh (1999) inferred three main evolutionary lineages in the study sample of twenty-one taxa of Cordyceps, Beauveria, and Tolypocladium using ITS nrDNA sequences.…”

Section: Introductionmentioning

confidence: 99%

Towards a phylogenetic classification of Cordyceps: ITS nrDNA sequence data confirm divergent lineages and paraphyly

Stensrud

Hywel‐Jones

Schumacher

2005

Mycological Research

View full text Add to dashboard Cite

The ascomycetous genus Cordyceps accommodates endoparasitic species that attack arthropods or other fungi. Analyses of ITS nrDNA sequence data of 72 taxa from the teleomorph genera Cordyceps, Claviceps, Epichloe¨, and the anamorph genera Akanthomyces, Beauveria, Metarhizium, Hirsutella, Hymenostilbe, Paecilomyces, Polycephalomyces, and Tolypocladium assigned the taxa to four main evolutionary lineages not reflected in the current classification of Cordyceps. Ten subclades were recognized from separate analyses of data subsets. Judged from the ITS phylogenies, Cordyceps spp. with branched stromata were highly supported as a divergent lineage. Host specificity was found to be of limited phylogenetic significance, and several host shifts are suggested to have occurred during the evolution of Cordyceps. Similar ascospore morphology was not reflected in the phyletic groups, and closely related taxa showed large interspecific variation with respect to the number of segments in which the ascospores are divided. However, combinations of selected characters were found to delimitate some lineages, e.g. all Cordyceps spp. that attack hosts in the insect orders Coleoptera and Lepidoptera, and with non-immersed perithecia and clavate to acicular, brightly yellowish to reddish stromata, constituted a separate clade. Furthermore, all Cordyceps spp. with perithecia obliquely immersed in the stroma were recognized as a distinct monophyletic group. This clade is additionally characterized by the formation of anamorphs ascribable to the genus Hymenostilbe. The mycogenous Cordyceps spp. grouped in a separate subclade, interspersed by two cicadaen parasites and all Tolypocladium spp. except T. parasiticum. Tolypocladium and Beauveria were found to be polyphyletic. The included Claviceps and Epichloe¨taxa appeared to be derived within Cordyceps, thus making Cordyceps paraphyletic as suggested in other studies.

show abstract

“…The ITS1-5.8S-ITS2, 28S and 18S ribosomal regions of the helicosporidial DNA were amplified with a mixture of Taq DNA polymerase (Promega) and Pfu polymerase (Stratagene), using the primers TW81 and AB28 for the ITS-5.8S (Curran et al, 1994) and NL-1 and NL-4 primers for the 28S (Kurtzman & Robnett, 1997). Two primer sets, designed from consensus regions of selected fungal, algal and protozoan sequences downloaded from GenBank, were used to amplify the 18S region.…”

Section: Methodsmentioning

confidence: 99%

Phylogenetic analysis identifies the invertebrate pathogen Helicosporidium sp. as a green alga (Chlorophyta).

Tartar

Boucias²,

Adams³

et al. 2002

International Journal of Systematic and Evolutionary Microbiology

View full text Add to dashboard Cite

Historically, the invertebrate pathogens of the genus Helicosporidium were considered to be either protozoa or fungi, but the taxonomic position of this group has not been considered since 1931. Recently, a Helicosporidium sp., isolated from the blackfly Simulium jonesi Stone & Snoddy (Diptera : Simuliidae), has been amplified in the heterologous host Helicoverpa zea. Genomic DNA has been extracted from gradient-purified cysts. The 18S, 28S and 5.8S regions of the Helicosporidium rDNA, as well as partial sequences of the actin and β-tubulin genes, were amplified by PCR and sequenced.Comparative analysis of these nucleotide sequences was performed using neighbour-joining and maximum-parsimony methods. All inferred phylogenetic trees placed Helicosporidium sp. among the green algae (Chlorophyta), and this association was supported by bootstrap and parsimony jackknife values. Phylogenetic analysis focused on the green algae depicted Helicosporidium sp. as a close relative of Prototheca wickerhamii and Prototheca zopfii (Chlorophyta, Trebouxiophyceae), two achlorophylous, pathogenic green algae. On the basis of this phylogenetic analysis, Helicosporidium sp. is clearly neither a protist nor a fungus, but appears to be the first described algal invertebrate pathogen. These conclusions lead us to propose the transfer of the genus Helicosporidium to Chlorophyta, Trebouxiophyceae.

show abstract

Phylogeny of Metarhizium: analysis of ribosomal DNA sequence data

Cited by 148 publications

References 11 publications

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Towards a phylogenetic classification of Cordyceps: ITS nrDNA sequence data confirm divergent lineages and paraphyly

Phylogenetic analysis identifies the invertebrate pathogen Helicosporidium sp. as a green alga (Chlorophyta).

Contact Info

Product

Resources

About