Phylogeny and historical biogeography of the cave‐adapted shrimp genus Typhlatya (Atyidae) in the Caribbean Sea and western Atlantic

Abstract

Aim To infer phylogenetic relationships among five species of the cave-adapted shrimp genus Typhlatya in order to test competing hypotheses of dispersal and colonization of the disjunct cave localities occupied by these five species.Location Typhlatya species are found in caves and anchialine ponds across the northern margin of the Caribbean Sea, along the Mediterranean and Adriatic coasts and on oceanic islands in the Atlantic and eastern Pacific oceans. This study focuses on five species, one from Bermuda, one from the Caicos Islands and three from the Yucatan Peninsula of Mexico.Methods Partial sequences (c. 1400 bp) from the mitochondrial cytochrome b, 16S rDNA and COI genes were obtained from representative samples of the five species. Phylogenetic inference was carried out with maximum parsimony and maximum likelihood analyses. Parsimony networks were constructed for the Bermudian species Typhlatya iliffei and one Yucatan species Typhlatya mitchelli, to determine the degree of connectivity among populations inhabiting different cave systems.Results All three land masses were recovered as monophyletic. The two insular marine species from Bermuda and the Caicos Islands formed a clade, while the three continental freshwater species from the Yucatan Peninsula formed another. Within both Bermuda and the Yucatan, shared haplotypes were found in different cave systems, suggesting recent or ongoing gene flow among populations in both locales. Main conclusionsThe two insular marine Typhlatya species originated from an ancestral marine population, possibly already cave-adapted, that is suggested to have colonized the Caicos Islands and subsequently dispersed to Bermuda via the Gulf Stream. Divergence estimates suggest that colonization occurred before the formation of present-day anchialine cave habitat, which did not form on either island until the late Pliocene to early Pleistocene. Divergence estimates also indicate that the Yucatan freshwater species split before the formation of freshwater cave habitat in the Yucatan. These species could have inhabited crevicular marine habitats before the late Pliocene/early Pleistocene in the Yucatan or elsewhere in the Caribbean, and subsequently migrated to freshwater caves once they formed.

Evolution and phylogeny of the mud shrimps (Crustacea: Decapoda) revealed from complete mitochondrial genomes

“…Four partial fragments of the genes cob , cox1 cox2 (2 kb), cox3 , srRNA were first determined by PCR with the primer sets of Cyb1/Cyb2 [78] crust-cox1f [79]/CCO2Rv1 [80], S cox3 -F(GCCCCTTCAGTNGAAATTGG)/S cox3 -R (ACTACATCDACRAAATGTCAATATCA), and srRNA -F (AAATTTAATTCAACATCGAGGTCGCAAACT)/ srRNA -R (TTGACYGTGCRAAGGTAGCATAATAATTAG). Additional three partial mitochondrial sequences ( nad4 , nad5 and 12S ) of T .…”

Evidence for population fragmentation within a subterranean aquatic habitat in the Western Australian desert

“…This latter hypothesis of post-isolation colonisation, in which a population is fragmented by a geographic barrier (vicariance) and subsequently rejoined, has been demonstrated in many epigean species (Zamudio and Savage, 2003;Phillips et al, 2004;Hoskin et al, 2005;Pinceel et al, 2005). Such a scenario has also been documented from a broad range of cavernicolous habitats and is a plausible hypothesis for the taxa within the LDC aquifer system (Cobolli Sbordoni et al, 1990;Crouau-Roy and Bakalowicz, 1993;Buhay and Crandall, 2005;Hunter et al, 2008).…”

On the origin of Danielopolina baltanasi sp. n. (Ostracoda, Thaumatocypridoidea) from three anchialine caves on Christmas Island, a seamount in the Indian Ocean

“…Recent papers dealing with the origin of anchialine faunas on isolated seamount islands provide the background literature Hunter et al, 2008). Shallow water ocean dispersal of anchialine fauna has been supported (Kano & Kase, 2004) but Bermuda, like Christmas Island, is surrounded by abyssal ocean more than 4000 m deep (Vogt & Jung, 2007) and the presence there of certain lineages of anchialine fauna has been attributed to ocean dispersal on the Gulf Stream from the Caribbean (Hunter et al, 2008).…”

“…Shallow water ocean dispersal of anchialine fauna has been supported (Kano & Kase, 2004) but Bermuda, like Christmas Island, is surrounded by abyssal ocean more than 4000 m deep (Vogt & Jung, 2007) and the presence there of certain lineages of anchialine fauna has been attributed to ocean dispersal on the Gulf Stream from the Caribbean (Hunter et al, 2008). Given the occurrence of D. kornickeri in Western Australia, dispersal was considered a potential source for the Christmas Island population, but this is negated herein by the designation of the two Indian Ocean Danielopolina to different subgenera.…”