Phylogenetic position of eight Amphora sensu lato (Bacillariophyceae) species and comparative analysis of morphological characteristics

Halamphora oceanica (Catenulaceae, Bacillariophyta), a new species from the epipelagic region of the southwestern Gulf of Mexico

“…Archibald & Schoeman 1984). For example, specimens and populations have been associated with this species despite the fact that there is a great difference in morphology and morphometry (e.g., Sala et al 1998;Pniewski et al 2010;Wang et al 2014;Rochín-Bañaga et al 2015). This is also observed through the current analysis (Fig.…”

“…In addition to these, other sequences such as Asterionella formosa Hassall (1850: 9-10), Rhizosolenia hyalina Ostenfeld in Ostenfeld & Schmidt (1902: 160), Helicotheca tamesis (Shrubsole) M. Ricard (1987: 75), Thalassiosira rotula Meunier (1910: 264), and Chaetoceros rostratus Ralfs in Lauder (1864: 79) were chosen as members of families that conform to outgroups based on previous reports (Wang et al 2014).…”

“…The amplification was carried out in 12.5 μl: 9.39 μL of H 2 O, 1.25 μL of Buffer 10 ×, 0.25 μL of dNTP, 0.125 μL of 18S-F53, 0.125 μL of 18S-R1335, 0.5 μL of MgCl 2 , 0.0625 μL of Taq polymerase, and 0.3 μL of DNA. The PCR cycling was conducted in a PCR System 9700 (Applied Biosystems; Foster City, California 94404, USA) under the following conditions: pre-denaturation at 94 °C for 4 min, 37 cycles of 94 °C for 20 s, 56 °C for 30 s, 72 °C for 50 s, and a final extension at 72 °C for 5 min following the procedure described by Wang et al (2014). The PCR products were visualized by electrophoresis in an agarose gel at 1% with TBE 1× and GelRed Nucleic Acid Gel Stain (Biotium).…”

“…Quantization and measurement of the quality of obtained DNA were done in a Thermo Scientific NanoDrop ND 2000c spectrophotometer (Thermo Fisher Scientific, U.S.A.). Expressions of SSU of the 18S gene were performed using the following primers proposed by Wang et al (2014): 18S-F53 (TTGTCTCAAAGATTAAGCCATG) and 18S-R1335 (CCTGTTATTGCCCCTATCTTCC), both from 5´ to 3´. The PCR reaction was prepared using a commercial kit (Taq Core PCR Kit; Qiagen, Hilden, Germany) following the manufacturer's protocols, adding 0.5 μl of a 0.4% aqueous solution of bovine serum albumin (BSA) to neutralize potential inhibitors (Kreader 1996).…”

“…Sato et al (2013) tested the phylogenetic relations among different sections of Amphora sensu lato and suggested that Halamphora is probably monophyletic. Wang et al (2014), based on morphological and molecular analysis of the small subunit rDNA, suggested that Amphora sensu lato species were not a monophyletic group. These analyses provide evidence that Halamphora Levkov is independent of Amphora Cleve.…”