Phylogenetic Diversity and Cosymbiosis in the Bioluminescent Symbioses of “Photobacterium mandapamensis”

Abstract

"Photobacterium mandapamensis" (proposed name) and Photobacterium leiognathi are closely related, phenotypically similar marine bacteria that form bioluminescent symbioses with marine animals. Despite their similarity, however, these bacteria can be distinguished phylogenetically by sequence divergence of their luminescence genes, luxCDAB(F)E, by the presence (P. mandapamensis) or the absence (P. leiognathi) of luxF and, as shown here, by the sequence divergence of genes involved in the synthesis of riboflavin, ribBHA. To gain insight into the possibility that P. mandapamensis and P. leiognathi are ecologically distinct, we used these phylogenetic criteria to determine the incidence of P. mandapamensis as a bioluminescent symbiont of marine animals. Five fish species, Acropoma japonicum (Perciformes, Acropomatidae), Photopectoralis panayensis and Photopectoralis bindus (Perciformes, Leiognathidae), Siphamia versicolor (Perciformes, Apogonidae), and Gadella jordani (Gadiformes, Moridae), were found to harbor P. mandapamensis in their light organs. Specimens of A. japonicus, P. panayensis, and P. bindus harbored P. mandapamensis and P. leiognathi together as cosymbionts of the same light organ. Regardless of cosymbiosis, P. mandapamensis was the predominant symbiont of A. japonicum, and it was the apparently exclusive symbiont of S. versicolor and G. jordani. In contrast, P. leiognathi was found to be the predominant symbiont of P. panayensis and P. bindus, and it appears to be the exclusive symbiont of other leiognathid fishes and a loliginid squid. A phylogenetic test for cospeciation revealed no evidence of codivergence between P. mandapamensis and its host fishes, indicating that coevolution apparently is not the basis for this bacterium's host preferences. These results, which are the first report of bacterial cosymbiosis in fish light organs and the first demonstration that P. leiognathi is not the exclusive light organ symbiont of leiognathid fishes, demonstrate that the host species ranges of P. mandapamensis and P. leiognathi are substantially distinct. The host range difference underscores possible differences in the environmental distributions and physiologies of these two bacterial species.

Phylogenetic Analysis of the Incidence ofluxGene Horizontal Transfer inVibrionaceae

“…Photobacterium mandapamensis is a luminous species that is closely related to P. leiognathi; these two species can be distinguished by molecular phylogenetic criteria, by some phenotypic traits, and by their different host species ranges (1,33). Strain ajapo.4.20, isolated from the light organ of an acropomatid fish (Table 1), the primary symbiont of which is P. mandapamensis (33), was found here to carry two lux-rib operons. One operon, lux-rib 1 , was located adjacent to putA, the common and putatively ancestral chromosomal location for lux-rib genes in Photobacterium (3).…”

Developmental and Microbiological Analysis of the Inception of Bioluminescent Symbiosis in the Marine FishNuchequula nuchalis(Perciformes: Leiognathidae)

“…The primers CWLAforPl (GTTTTAGATCAA CTGTCTAAAGGRCG) and CWLArevPl (TCAGAACCATTCGCTTCAAAT CCAAC), designed for amplification of the luxA region from P. leiognathi (26), were used to amplify the luxA region from genomic DNA of N. nuchalis symbionts. For amplifications, Taq polymerase and reagents of the Eppendorf (Hamburg, Germany) MasterTaq kit were used with the following protocol: hot start and 2-min denaturing at 95°C; 35 cycles of 20 s at 94°C (denaturing), 15 s at 50°C (primer annealing), and 1 min at 72°C (polymerase extension); a single additional extension step of 7 min at 72°C; and snap cooling to 4°C.…”

“…DNA fingerprint analysis (genomotyping) was carried out by repetitive element palindromic PCR (rep-PCR) (49), essentially as described previously (13,26). The reaction mixture for rep-PCR contained the following (per 25-l reaction volume): 6.125 l of tissue culture-grade water (Sigma, St. Louis, MO), 5 l of 5ϫ Gitschier buffer, 0.2 l of bovine serum albumin (10 mg ml Ϫ1 ), 2.5 l of dimethylsulfoxide (100%), 3.125 l of deoxynucleoside triphosphates (10 mM), 1.25 l (each) of primers REPIR-1 (5Ј-IIIICGICGICATCIGGC-3Ј) and REP2-1 (5Ј-ICGICTTATCIGGCCTAC-3Ј) (50 nM), 2.5 l of MgCl 2 (25 mM), and 1 l of Taq polymerase (5 U l Ϫ1 ) (Eppendorf).…”

“…In the only experimental study, bacteria could be passed via seawater from adults to aposymbiotic juveniles to reinitiate the symbiosis (51). To date, four bacterial species, Aliivibrio fischeri, Photobacterium kishitanii, Photobacterium leiognathi, and "Photobacterium mandapamensis," have been identified as bioluminescent symbionts of fish (17,26,48).…”

“…Leiognathids bear an internal, supraesophageal light organ and typically harbor P. leiognathi as their light organ symbiont (7,9,12,21,26,43). The goals of the study were to identify the developmental stage at which the symbiosis begins in N. nuchalis, to determine whether initiation of light organ ontogeny precedes bacterial colonization, and to characterize the genetic diversity of bacteria initiating the association.…”