Phosphorylation of Fibroblast Growth Factor (FGF) Receptor 1 at Ser777 by p38 Mitogen-Activated Protein Kinase Regulates Translocation of Exogenous FGF1 to the Cytosol and Nucleus

Abstract

Exogenous fibroblast growth factor 1 (FGF1) signals through activation of transmembrane FGF receptors (FGFRs) but may also regulate cellular processes after translocation to the cytosol and nucleus of target cells. Translocation of FGF1 occurs across the limiting membrane of intracellular vesicles and is a regulated process that depends on the C-terminal tail of the FGFR. Here, we report that translocation of FGF1 requires activity of the ␣ isoform of p38 mitogen-activated protein kinase (MAPK). FGF1 translocation was inhibited after chemical inhibition of p38 MAPK or after small interfering RNA knockdown of p38␣. Translocation was increased after stimulation of p38 MAPK with anisomycin, mannitol, or H 2 O 2 . The activity level of p38 MAPK was not found to affect endocytosis or intracellular sorting of FGF1/FGFR1. Instead, we found that p38 MAPK regulates FGF1 translocation by phosphorylation of FGFR1 at Ser777. The FGFR1 mutation S777A abolished FGF1 translocation, while phospho-mimetic mutations of Ser777 to Asp or Glu allowed translocation to take place and bypassed the requirement for active p38 MAPK. Ser777 in FGFR1 was directly phosphorylated by p38␣ in a cell-free system. These data demonstrate a crucial role for p38␣ MAPK in the regulated translocation of exogenous FGF1 into the cytosol/nucleus, and they reveal a specific role for p38␣ MAPK-mediated serine phosphorylation of FGFR1.Fibroblast growth factor 1 (FGF1) belongs to a family of heparin binding polypeptide growth factors encoded by 22 genes in mice and humans (20). Most FGFs transmit signals to cells by binding and through activation of a family of highaffinity, tyrosine kinase FGF receptors (FGFR1 to -4) (7). FGF1 and FGF2 may, in addition, be translocated from the extracellular space into the cytosol and nucleus of target cells (37,39,46,58). Translocated FGF1 and FGF2, in particular nuclear FGF1 and FGF2, have been reported to be involved in regulating processes such as rRNA synthesis and cell growth (17-19, 21, 36, 44, 45, 52, 54, 56, 61).The translocation of exogenous FGF1 or FGF2 into the cytosol and nucleus is a highly regulated process that requires phosphatidylinositol 3-kinase (PI3K) activity (23) and active hsp90 (52) and is strictly dependent on binding of FGF to either FGFR1 or FGFR4 (47). Furthermore, translocation was found to be cell cycle dependent (3, 31, 63), it can be stimulated by serum deprivation of cells (1,3,18,25,31,32,55,63), and it occurs after a several-hour delay compared to the endocytic uptake of FGF (31, 47). The nuclear trafficking of FGF1 is also tightly regulated by two nuclear localization sequences (19, 51), a nuclear export sequence (36), and by phosphorylation of FGF1 at Ser130 by protein kinase C␦ (PKC␦) (57).The actual translocation of FGF across cellular membranes appears to occur in early endosomes, as it was found to depend on the electrical potential across vesicular membranes (31, 32). Extensive unfolding of the growth factor is not required for the translocation to occur (53). It is not known exact...

Internalization of biotinylated compounds into cancer cells is promoted by a molecular Trojan horse based upon core streptavidin and clostridial C2 toxin

“…In order to study the internalization of the fusion protein in a variety of cell lines, we performed digitonin-based cell fractionation as reported previously (Sorensen et al 2008). HeLa cervical carcinoma cells treated with C2IN-Stv13 and the binding/translocation component C2IIa displayed a time-dependent accumulation of C2IN-Stv13 in the cytosol with a maximum of protein translocated after 4 h (Fig.…”

“…To study the cytosolic translocation of the C2IN-Stv13 fusion protein, digitonin-based cell fractionation was used according to Sørensen and co-workers (Sorensen et al 2008). Briefly, cells grown in 12-well plates were preincubated in serum-free medium for 15 min and then supplemented with a combination of C2IN-Stv13 (2 μg/ml) and C2IIa (4 μg/ml).…”

Inhibition and Genetic Deficiency of p38 MAPK Up-Regulates Heme Oxygenase-1 Gene Expression via Nrf2

“…Two siRNA sequences, GAACGUUGUUUCCUGGUACTT (␣1) and GAUGCUCGUUUUGGACUCAG (␣2), targeting mouse p38␣ mRNA were the same as previously published (28) and HPLC purified (MWG Biotech) with 2-nt 3Ј terminal dTdT overhangs at each strand. A negative control siRNA was obtained from Dharmacon.…”

The Protein Phosphatase 2A Regulatory Subunits B′β and B′δ Mediate Sustained TrkA Neurotrophin Receptor Autophosphorylation and Neuronal Differentiation

“…4C). Since Ser/Thr phosphorylation of several growth factor receptors has been associated with tyrosine kinase inhibition (5,7,11,16,34,35,44,55), these results raise the possibility that PP2A promotes TrkA activity by dephosphorylating inhibitory Ser/Thr phosphorylation sites.…”

“…1) suggests that the Ser/Thr phosphatase opposes a delayed, Trk-specific desensitization mechanism. Ser/Thr phosphorylation of several receptor tyrosine kinases has been re- (5,7,11,16,34,35,44,55). In the case of the hepatocyte growth factor receptor cMET, PP2A dephosphorylates an inhibitory protein kinase C phosphorylation site in the tyrosine kinase domain, thereby keeping cMET active (20).…”