Phosphorothioated DNA Is Shielded from Oxidative Damage

Abstract

DNA is the carrier of genetic information. DNA modifications play a central role in essential physiological processes. Phosphorothioation (PT) modification involves the replacement of an oxygen atom on the DNA backbone with a sulfur atom. PT modification can cause genomic instability inSalmonella entericaunder hypochlorous acid stress. This modification restores hydrogen peroxide (H2O2) resistance in the catalase-deficientEscherichia coliHpx−strain. Here, we report biochemical characterization results for a purified PT modification protein complex (DndCDE) fromS. enterica. We observed multiplex oligomeric states of DndCDE by using native PAGE. This protein complex bound avidly to PT-modified DNA. DndCDE with an intact iron-sulfur cluster (DndCDE-FeS) possessed H2O2decomposition activity, with aVmaxof 10.58 ± 0.90 mM min−1and a half-saturation constant,K0.5S, of 31.03 mM. The Hill coefficient was 2.419 ± 0.59 for this activity. The protein’s activity toward H2O2was observed to be dependent on the intact DndCDE and on the formation of an iron-sulfur (Fe-S) cluster on the DndC subunit. In addition to cysteine residues that mediate the formation of this Fe-S cluster, other cysteine residues play a catalytic role. Finally, catalase activity was also detected in DndCDE fromPseudomonas fluorescensPf0-1. The data and conclusions presented suggest that DndCDE-FeS is a short-lived catalase. Our experiments also indicate that the complex binds to PT sites, shielding PT DNA from H2O2damage. This catalase shield might be able to extend from PT sites to the entire bacterial genome.IMPORTANCEDNA phosphorothioation has been reported in many bacteria. These PT-hosting bacteria live in very different environments, such as the human body, soil, or hot springs. The physiological function of DNA PT modification is still elusive. A remarkable property of PT modification is that purified genomic PT DNA is susceptible to oxidative cleavage. Among the oxidants, hypochlorous acid and H2O2are of physiological relevance for human pathogens since they are generated during the human inflammation response to bacterial infection. However, expression of PT genes in the catalase-deficientE. coliHpx−strain restores H2O2resistance. Here, we seek to solve this obvious paradox. We demonstrate that DndCDE-FeS is a short-lived catalase that binds tightly to PT DNA. It is thus possible that by docking to PT sites the catalase activity protects the bacterial genome against H2O2damage.

An in vitro DNA phosphorothioate modification reaction

“…Recently, we showed that the Fe‐S cluster of DndC is in the [4Fe‐4S] configuration (Pu et al, ). The cluster has a g value peak of 2.005 at 13 K. The cluster can be deprived off by α,α’‐dipyridyl treatment and reconstituted back using cysteine and (NH 4 ) 2 Fe(SO 4 ) 2 with the catalysis of IscS under anoxic conditions (Figure ).…”

“…(b) The involvement of the iron‐sulfur cluster in the PT reaction. The Dnd protein complex used in the reaction was anoxically reconstituted (dark green, resulting in a [4Fe‐4S] cluster; Pu et al, ), oxically purified (brown, [3Fe‐4S]) or treated using 1 mM α,α'‐dipyridyl (gray), which removed the Fe‐S cluster [Colour figure can be viewed at wileyonlinelibrary.com]…”

“…DndC protein from S. lividans was previously shown to contain a 4Fe‐4S cluster (You et al, ). We characterize recently the 4Fe‐4S cluster using EPR (Pu et al, ). We suspected that DndC is a radical SAM enzyme because the 4Fe‐4S cluster is coordinated by three rather than four cysteine residues (Figure ).…”

“…Synthetic dinucleotide dG S A and dG S T standards were purchased from GENEWIZ (Jiangsu, China). The bacterial strains and plasmids used in this work, except for the DndD mutant R217C, have been described in previous publications (Pu et al, ; Xiong et al, ). The primers used to generate the DndD mutant R217C were 5′‐TTATCAAATGCCAGCAAACTGCCCAGTTGGGTGGCTC‐3′ and 5′‐GTTTGCTGGCATTTGATAAAAATCATCAGATCATTTT‐3′.…”

“…The primers used to generate the DndD mutant R217C were 5′‐TTATCAAATGCCAGCAAACTGCCCAGTTGGGTGGCTC‐3′ and 5′‐GTTTGCTGGCATTTGATAAAAATCATCAGATCATTTT‐3′. The mutation protocol had been described by Pu et al (). Bacterial cell culture conditions, protein expression and purification of His‐tagged cysteine desulfurase (IscS) and DndCDE were also described in detail in a previous publication.…”