Phenotypic and QTL analyses of herbage production-related traits in perennial ryegrass (Lolium perenne L.)

Abstract

Phenotypic and genetic evaluation of morphological traits associated with herbage biomass production was undertaken in a perennial ryegrass (Lolium perenne L.) biparental F 1 mapping population (n = 200) with parent plants from cultivars 'Grasslands Impact' and 'Grasslands Samson'. Morphological traits measured on three clonal replicates of the parental genotypes and 200 F 1 progeny in a glasshouse in two separate trials (autumn and spring) included: dry weight (DW), leaf elongation rate (LER), initial tiller number (TNs), final tiller number (TNe), site filling (Fs), tiller weight (TW), leaf lamina length, leaf tip and ligule appearance rates (ALf, ALg) and leaf elongation duration (LED). Principal component analysis of patterns of trait association identified negative correlation between TNs or TNe, and TW as the primary basis for morphological difference and indicated that either high LER or long LED could reduce TN. Plants with higher LER tended to have increased DW. Quantitative trait loci (QTL) were detected on all seven linkage groups (LG) of a perennial ryegrass linkage map for all but three traits. A total of 61 QTL were identified, many of which clustered at 15 shared genome locations. Significant genotype by environment effects were encountered, evidenced both by variation between experiments in genotype rankings and by a general lack of commonality for QTL for the same traits in the different experiments. Only five QTL, for ALf, ALg and TN, were conserved between autumn and spring trials. A QTL for TN and DW on LG6 is a strong candidate for application of MAS in future plant improvement work and was found to be co-linear with QTL for equivalent traits reported on chromosome 2 in rice.

Leaf Length Variation in Perennial Forage Grasses

“…In one location, during one growing phase, on spaced-plants and on equivalent leaves (same rank), leaf length broad-sense heritability (H 2 ) is high: above 0.65 [37][38][39]. It decreases when several environments and/or years are taken into account and also, as expected, when reproductive and vegetative growing stages are included: 0.3-0.6 [38,[40][41][42][43]. Differences in vernalization requirements between genotypes exist in perennial grasses [44][45][46] and could lead to differences in the date of flower induction, which in turn could lead to differences in leaf length.…”

Comparative Genomics and Functional Characterisation of the GIGANTEA Gene from the Temperate Forage Perennial Ryegrass Lolium perenne

“…A 689-bp fragment of the LpGI gene was amplified from genomic DNA of the parents (Impact and Samson) of the F 1 full-sibling mapping population 'IxS' (Faville et al 2012;Sartie et al 2011) using Platinum Taq Polymerase (Invitrogen) and primers GIK16/GIK17 (CATGAAATGT GCAGAACAGG and TGGTTGACTCTCCACATCTTC), with the amplification conditions of 2 min at 95°C, 40 cycles of three steps of 30 s of 95°C, 30 s of 54°C and 45 s of 72°C. The fragments were cloned and sequenced to discover polymorphisms.…”

Quantitative Trait Loci (QTL) Identification in the Progeny of a Polycross

“…Moreover this QTL was near LpSSR082 which is close to the gene Gibberellic Acid Insensitive [9], which is involved in leaf elongation rate and leaf length [7]. The QTL on LG3 was not far from a QTL for leaf elongation rate in [32] (marker pps0164 in common) and in [34] (marker 25ca1 in common), but the very low number of common markers between studies does not allow a real accurate comparison. In the literature cited above, QTL were identified on all seven LG with the percentages of phenotypic variance explained by the QTL ranging from 5% to 43%.…”

“…These regions have already been identified as QTL involved in traits related to leaf growth, such as leaf length, leaf elongation rate, and plant height [22,24,[31][32][33][34][35]. In particular, the QTL on LG4 nearby LpSSR011 and G05_014 is located on the map of [22] nearby a QTL for leaf elongation rate, lamina length, and plant height.…”