Pharmacological Targeting of Plasminogen Activator Inhibitor-1 Decreases Vascular Smooth Muscle Cell Migration and Neointima Formation

Abstract

Objective Plasminogen activator inhibitor-1 (PAI-1), a serine protease inhibitor that promotes and inhibits cell migration, plays a complex and important role in adverse vascular remodeling. Little is known about the effects of pharmacological PAI-1 inhibitors, an emerging drug class, on migration of vascular smooth muscle cells (SMCs) and endothelial cells (ECs), crucial mediators of vascular remodeling. We investigated the effects of PAI-039 (tiplaxtinin), a specific PAI-1 inhibitor, on SMC and EC migration in vitro and vascular remodeling in vivo. Approach and Results PAI-039 inhibited SMC migration through collagen gels, including those supplemented with vitronectin and other extracellular matrix proteins, but did not inhibit migration of PAI-1-deficient SMCs, suggesting that its anti-migratory effects were PAI-1-specific and physiologically relevant. However, PAI-039 did not inhibit EC migration. PAI-039 inhibited phosphorylation and nuclear translocation of STAT-1 in SMCs, but had no discernable effect on STAT-1 signaling in ECs. Expression of LDL receptor-related protein 1 (LRP1), a motogenic PAI-1 receptor that activates JAK/STAT-1 signaling, was markedly lower in ECs than in SMCs. Notably, PAI-039 significantly inhibited intimal hyperplasia and inflammation in murine models of adverse vascular remodeling, but did not adversely affect re-endothelialization after endothelium-denuding mechanical vascular injury. Conclusions PAI-039 inhibits SMC migration and intimal hyperplasia, while having no inhibitory effect on ECs, which appears to be due to differences in PAI-1-dependent LRP1/JAK/STAT-1 signaling between SMCs and ECs. These findings suggest that PAI-1 may be an important therapeutic target in obstructive vascular diseases characterized by neointimal hyperplasia.

Plasminogen activator inhibitor‐1 regulates the vascular expression of vitronectin

“…Our data obtained with recombinant PAI‐1 mutants and anti‐LRP1 antibody suggest that binding of PAI‐1 to LRP1 is required to enhance VN expression. Binding of PAI‐1 to LRP1 activates intracellular signaling pathways that regulate gene expression, including JAK–STAT1 signaling . It is of note that we observed significantly greater stimulation of VN gene expression by PAI‐1‐AK, which does not bind VN, than by PAI‐1‐14‐1B; this is most likely explained by the recognized capacity of VN to downregulate the binding of PAI‐1 to LRP1 .…”

“…Total RNA was isolated from cells and tissues by the use of TRIzol (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer's instructions. cDNA was synthesized with a Prime Script RT reagent kit (Takara Bio, Mountain View, CA, USA), subjected to qRT‐PCR with the SYBR Green method, and quantified with the 2 −ΔΔCT method, as described previously . For amplification of murine PAI‐1, the sequences 5′‐GCTGCAGATGACCACAGCGGG‐3′ and 5′‐CCGCAGTACTGATCTCATTC‐3′ were used as forward and reverse primers, respectively.…”

Thrombotic Regulation From the Endothelial Cell Perspectives

“…It functions as the principal inhibitor of tissue-or urokinase-type plasminogen activator, and hence fibrinolysis, with additional nonfibrinolytic function recently discovered. [45][46][47] PAI-1 is mainly produced by the endothelium but is also secreted by other tissue types, such as adipose tissue. Elevated PAI-1 is a risk factor for thrombosis and atherosclerosis.…”

Effects of 17β-Estradiol on the Plasminogen Activator System in Vascular Smooth Muscle Cells Treated with Lysophophatidylcholine

“…On the other hand, PAI-1 plays a crucial role in vascular remodeling. PAI-1 is involved in pathological intimal hyperplasia [22]. PAI-1 also reduces VSMC migration, likely resulting in a thinned fibrous atheroma cap [2].…”