Pharmacologic Stabilization of Retromer Rescues Endosomal Pathology Induced by Defects in the Alzheimer’s geneSORL1

Abstract

Defects in the Sortilin-related receptor 1 gene, SORL1, are highly pathogenic in Alzheimer's disease (AD), on par with other causal AD genes. SORL1 is a key regulator of endosomal trafficking in neurons, and loss of SORL1 function disrupts trafficking pathways that are vital for neuronal health. SORL1 has been found to interact with retromer, a protein complex that is a 'master conductor' of endosomal trafficking. Here we rely on retromer pharmacological chaperones that stabilize retromer in vitro, and thus enhance retromer function in cells. to test the hypothesis that they will correct AD-associated neuronal pathologies. We used an isogenic series of human induced pluripotent stem cell (hiPSCs) lines either deficient in SORL1 expression (SORL1 KO or SORL1+/-) or harboring one copy of a missense variant linked to increased risk for AD (SORL1Var). We treated neurons derived from these hiPSCs with the established retromer chaperone, TPT-260, and tested whether they corrected indicators of AD's defining endosomal, amyloid, and Tau pathologies. We observed that TPT-260 treatment was able to correct all these pathological indicators; however, the degree of rescue of some of the phenotypes was dependent on whether the neurons harbor at least one functional copy of SORL1 or whether they are fully deficient. More than just validating that SORL1-retromer acts as a functional trafficking unit in neurons, our work sheds new light on how SORL1-retromer is linked to AD's cardinal pathologies and illuminates how this pathway can be therapeutically harnessed.

Cell-type-specific regulation of APOE and CLU levels in human neurons by the Alzheimer’s disease risk gene SORL1

“…We next examined iPSC-derived neurons that harbor a SORL1 mutation, Gly511Arg, originally identified in a mother and daughter who each had early-onset AD 3 along with paired isogenic SORL1 WT neurons. 45 As in SORL1 KO iNs, heterozygous G115R mutation of SORL1 was sufficient to induce a reduction in APOE and CLU in neurons ( Figures 7L – 7P ). In addition, lipidomic profiling of G511R iNs revealed three classes of lipids that showed concordant dysregulation with SORL1 KO iNs: DG, HexCer, and Hex3Cer ( Figures 7Q – 7T ).…”

“…Description and characterization of SORL1 variant iPSCs containing heterozygous G511R variant have been previously published. 45 gRNA ‘CTCTTGCATTTTAGGCTCAG’ and G511R ssODN: CTGACATATTCTTGAAATTAAAAATAATTATTTCTCTTGCATTTTAGGCTCAGTGCGAAAGAACTTGGCTAGCAAGACAAACGTGTACATCTCTAGCAGTGCTGGAGCCAGGTGGCG was used to target VPS10p domain in iPSC line 1, which is the same iPSCs used to generate SORL1 KO iPSCs. The Zhang Lab CRISPR Design website ( crispr.mit.edu ) was used to generate guide RNAs (gRNAs) with minimal off-target effects.…”

Functional characterization of SORL1 variants in cell-based assays to investigate variant pathogenicity

“…It is therefore likely that iPSC neurons with pathogenic SORL1 missense variants will also have larger endosomes compared with wild-type cells, which suggests that studying endosomal size is an alternative method to determine SORL1 variant pathogenicity. A recent study has followed this strategy and demonstrated that indeed endosome structures are also increased in cells with different SORL1 missense variants [ 33 ].…”

Behavioural pharmacology predicts disrupted signalling pathways and candidate therapeutics from zebrafish mutants of Alzheimer’s disease risk genes

“…Retromer is a large protein complex which ‘rescues’ proteins from endosomes, targeting them to recycling instead of lysosomal digestion 76 . By disrupting retromer function, mutations in SORL1 disrupt endosomal recycling, which appears as swelling of early endosomes 77 . As a result, APP remains in endosomes for longer, where it is more likely to be cleaved by β-secretase, the first step towards production of Aβ 78 .…”