Persistence of HIV drug resistance among South African children given nevirapine to prevent mother-to-child-transmission

Abstract

Objectives We set out to examine the prevalence and persistence of mutations conferring high-level nonnucleoside reverse transcriptase (NNRTI)-resistance in a cohort of HIV-infected children who had failed prophylaxis to prevent mother-to-child-transmission (PMTCT). Design A prospective observational cohort study at the Pediatric HIV Clinic at Kalafong Provincial Tertiary Hospital in Pretoria, South Africa. Methods Children referred for initiation of antiretroviral therapy (ART) were enrolled from July 2010 through February 2013. HIV drug resistance testing was performed using the oligonucleotide ligation assay (OLA) on dried blood spots (DBS) collected at enrolment and monthly follow-up visits for 2 years. Results South African children who failed HIV-prophylaxis had a high prevalence of NNRTI-resistant HIV (46/88; 52%). Among children with NNRTI-resistance, the frequency of the predominant resistant variant in each child’s HIV-quasispecies was high (median 96%) at study entry (median age 7.5 months), and in 26 out of 27 followed a median of 13 months persisted at a high frequency (median 89%). Conclusion Our finding that infants who fail HIV-prophylaxis frequently have long-lived NNRTI-resistant HIV suggests that resistance will likely persist through 36 months of age, when children qualify for NNRTI-based ART. These children may benefit from HIV drug resistance testing to guide selection of their treatment.

Association of Virologic Failure and Nonnucleoside Reverse Transcriptase Inhibitor Resistance Found in Antiretroviral-Naive Children Infected With Human Immunodeficiency Virus and Given Efavirenz-Based Treatment

“…Studies of pediatric PDR among PPT-unexposed children in Africa near the time of this study (2010-2013) reported rates that ranged from 7.7% in Uganda to 26.8% in Togo [6], and a systematic review and meta-analysis that included children from more than 13 countries in sub-Saharan Africa estimated a prevalence of NNRTI PDR of 9.7% [7]. The lower rate of PDR that we observed could be attributed to our use of OLA, designed to detect only 4 DRMs that confer high-level resistance to NNRTIs selected by NVP or EFV [5], whereas other studies used consensus sequencing and counted DRMs that conferred any level of reduced susceptibility to NNRTIs [6,8,9].…”

“…Dried blood spots (DBSs) prepared on Whatman FTA cards (GE Healthcare Life Sciences, Chicago, Illinois) were processed as described [5], and ≥100 viral templates were amplified by nested HIV-1 pol DNA polymerase chain reaction (PCR) with first-round (forward, CCTACACCTGTCAACATAATTGG, and reverse, CAyTTGTCAGGATGGAGTTCATA) and secondround (forward, AATTAAAGCCAGGAATGGATGG, and reverse, CAAAGGAATGGAGGTTCTTTCTGATG) primers. If a DBS specimen was not available, RNA was extracted from 0.4 to 1 mL of plasma using the QIAamp viral RNA minikit (Qiagen, Valencia, California).…”

“…Reverse transcription and PCR were carried out using the PrimeScript One Step RT-PCR kit (TaKaRa Bio USA, Inc, Mountain View, California). PCR products from each specimen were tested for HIV-1 NNRTI DRMs (K103N, V106M, Y181C, and G190A) using an oligonucleotide ligation assay (OLA) optimized for HIV-1 subtype C [5]. For specimens with an "indeterminate" result according to OLA (negative reaction for both mutant and wild-type genotypes), the genotype at the codon(s) in question was determined by consensus sequencing.…”

HIV-1 Subtype Diversity and Prevalence of Primary Drug Resistance in a Single-Center Pediatric Cohort in Germany

“…However, among those who do become infected, the prevalence of DRMs, especially NNRTI resistance, is high. A recently published prospective observational study from South Africa demonstrated a high prevalence of NNRTI resistance (52%) among infants who fail HIV-prophylaxis [29]. In another study from South Africa conducted in 2011, 56.8% of HIV-1-infected children harbored NNRTI, 14.8% harbored NRTI, and 1.3% harbored PI mutations [3].…”

OLA-Simple: A software-guided HIV-1 drug resistance test for low-resource laboratories

“…Each specimen was tested using OLA-Simple kit ( n = 1 for PCR and n = 1 for each mutation). Specimens from South Africa consisted of sixty DBS specimens from children aged 0–5 years pre-exposed to nevirapine prophylaxis, collected in 2010–2013 and stored at room temperature (∼25 °C) [23]. Specimens from Thailand consisted of thirty-eight first-round pol amplicon derived from plasma of HIV-infected adults and children enrolled in the PHPT-GFATM cohort treatment program (Observational Cohort of HIV Infected Adults and Children in the PHPT Network Hospitals in Thailand in 2002–2008 (ClinicalTrials.gov Identifier: NCT00433030) [21].…”