Peroxisome Proliferator-activated Receptor α (PPARα) Agonist Treatment Reverses PPARα Dysfunction and Abnormalities in Hepatic Lipid Metabolism in Ethanol-fed Mice

Abstract

Proper function of the peroxisome proliferator-activated receptor ␣ (PPAR␣) is essential for the regulation of hepatic fatty acid metabolism. Fatty acid levels are increased in liver during the metabolism of ethanol and should activate PPAR␣. However, recent in vitro data showed that ethanol metabolism inhibited the function of PPAR␣. We now report that ethanol feeding impairs fatty acid catabolism in the liver in part via blocking PPAR␣-mediated responses in C57BL/6J mice. Ethanol feeding decreased PPAR␣/retinoid X receptor ␣ binding in electrophoretic mobility shift assay of liver nuclear extracts. mRNAs for PPAR-regulated genes were reduced (long chain and medium chain acyl-CoA dehydrogenases) or failed to be induced (acyl-CoA oxidase, liver carnitine palmitoyl-CoA transferase, very long chain acyl-CoA synthetase, very long chain acyl-CoA dehydrogenase) in livers of the ethanol-fed animals, and ethanol feeding did not increase the rate of fatty acid ␤-oxidation. Wy14,643, a PPAR␣ agonist, restored the DNA binding activity of PPAR␣/retinoid X receptor ␣, induced mRNA levels of PPAR␣ target genes, stimulated the rate of fatty acid ␤-oxidation, and prevented fatty liver in ethanol-fed animals. Impairment of PPAR␣ function during ethanol consumption contributes to the development of alcoholic fatty liver, which can be overcome by Wy14,643.

Role of adiponectin in the protective action of dietary saturated fat against alcoholic fatty liver in mice

“…23 Previously, we reported that ethanol treatment slightly but significantly reduced both basal and clofibrate-stimulated PPAR-␥-dependent transcriptional activities, and the mRNA and protein levels of retinoid X receptor ␣ were decreased in chronic ethanol-fed mice. 13,14 Therefore, dietary fatty acids plus ethanol may regulate the adiponectin promoter activity through directly modulating PPAR-␥ function.…”

“…Frozen sections of the liver were stained with Oil Red O (Sigma) and total hepatic cholesterol and triglyceride levels were measured as previously described. 14 Assays From Mouse Serum. Serum levels of alanine aminotransferase (ALT) were determined using a kit from Sigma.…”

“…Quantitative reverse-transcriptase polymerase chain reaction was performed as described. 14 The messenger RNA (mRNA) levels were quantified using a QuantumRNA 18S internal standard kit (Ambion, Austin, TX) according to the manufacturer's instructions. The primers used are as follows: PGC-1␣, (5Јaatgcagcggtcttagcact3Ј)(5Јtttctgtgggtttggtgtga3Ј); acyl-CoA oxidase, (5Јcttgttcgcgcaagtgagg3Ј) (5Јcaggatc-cgactgtttacc3Ј).…”

“…Chronic ethanol administration in mice is associated with inhibition of AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor (PPAR) ␣, two critical signaling molecules controlling the pathways of hepatic fatty acid oxidation. [12][13][14][15] These molecules are the major mediators of the metabolic effect of adiponectin. 16,17 Adiponectin is exclusively expressed and secreted from adipose tissue.…”

Mitochondrial dysfunction and oxidative stress in the pathogenesis of alcohol- and obesity-induced fatty liver diseases

“…Similarly, the PPAR-γ agonist pioglitazone prevents alcohol induced liver injury through interactions with the c-Met signaling pathway resulting in decreased triglyceride synthesis [151]. It should also be mentioned that treatment with the PPAR-α agonist WY14,643 prevented alcohol induced steatosis via upregulation of β-oxidation activity [152]. However caution should be exercised when using these medications because recent reports have demonstrated mitochondrial abnormalities associated with rosiglitazone therapy in both experimental [153] and human patients [154] with NAFLD.…”