Perinatal lethality in H19 enhancers‐Igf2 transgenic mice

Abstract

The insulin-like growth factor II (IGFII) is a mitogen for a number of cell types in vitro and is required for normal embryonic growth. It has been hypothesized that overexpression of IGF2 is responsible for the increased growth and tumor predisposition in patients with Beckwith-Wiedemann syndrome. Association of increased levels of IGFII with increased growth is also incorporated in a current model for the evolution of Igf2 imprinting. Different experimental approaches to increasing IGFII levels in the mouse have yielded different results with respect to its effects on growth, viability, and tumor development. To investigate the consequences of IGf2 overexpression in the embryonic period, without alterations in the activity of other genes, we produced transgenic mice that express the Igf2 gene under the control of the H19 enhancers. Transgene expression in the embryonic period had no significant effect on the overall size of the embryos, but was associated with perinatal lethality in homozygous, and some heterozygous, mice. A large fraction of homozygous mice also developed a cleft palate. These findings indicate that overexpression of Igf2 can have an adverse effect on viability in the absence of a pronounced effect on overall body growth. The results are consistent with the view that growth and perinatal viability are affected differently by Igf2 overexpression in endodermal and mesodermal tissues.

Delayed Onset of Igf2-Induced Mammary Tumors in Igf2r Transgenic Mice

“…Purified DNA was microinjected into FVB/N embryos (30). Injected embryos were cultured overnight, and those that had divided were implanted into day 1 pseudopregnant fosters.…”

“…Mice with an inactive paternal Igf 2 are f40% smaller than their normal littermates (28), whereas mice with biallelic expression of IGF-II are larger (29). Higher levels of IGF-II in mice are often associated with perinatal lethality (30,31), and the late fetal or early postnatal lethality of mice with no active Igf2r genes is due to the increased IGF-II levels (7,32). Two active copies of IGF2 (due to loss of imprinting, paternal disomy, or paternal duplication) have been found in a significant portion of patients with Beckwith-Wiedemann syndrome (33), which is characterized by increased body and organ size and tumor predisposition.…”

“…We have described several lines of transgenic mice that express the mouse Igf 2 gene under the control of the H19 enhancers (30,35). The transgenes are expressed in several adult tissues, including the mammary glands, and induce mammary adenocarcinomas with a high incidence in parous females (ref.…”

Oligosyndactylism Mice Have an Inversion of Chromosome 8

“…viously (Wise and Pravtcheva 1997). Primers for RT-PCR of These results indicated the involvement of a second the 500-9 sequence were CAGACCCACCTCCACCTACT and genomic region in the Os mutation.…”

“…Southern analysis of DNA from 94 A/K transgenic mice DNA from cells, tissues, and embryos was isolated by standard with probes from the Anapc10 region indicated that both methods (Sambrook et al 1989;Hogan et al 1994 cation of cDNA ends (RACE) clone corresponding to Amplification of genomic DNA: Standard PCR was done by the method of Saiki (1990) as described in Wise and this novel mRNA species and have determined that se- Pravtcheva (1997). Primers for mapping the 500-9 region quences following Anapc10 exon 4 are missing from this were CAGCCTAGGTTTATTTATCA and CCCAGGATGCAA mRNA and are replaced by a short 150-nt fragment CAGTAATG.…”