Performance comparison of phenotypic and molecular methods for detection and differentiation of Candida albicans and Candida dubliniensis

Abstract

BackgroundCandida albicans is the most pathogenic Candida species but shares many phenotypic features with Candida dubliniensis and may, therefore, be misidentified in clinical microbiology laboratories. Candidemia cases due to C. dubliniensis are increasingly being reported in recent years. Accurate identification is warranted since mortality rates are highest for C. albicans infections, however, C. dubliniensis has the propensity to develop resistance against azoles more easily. We developed a duplex PCR assay for rapid detection and differentiation of C. albicans from C. dubliniensis for resource-poor settings equipped with basic PCR technology and compared its performance with three phenotypic methods.MethodsDuplex PCR was performed on 122 germ tube positive and 12 germ tube negative isolates of Candida species previously identified by assimilation profiles on Vitek 2 ID-YST system. Typical morphologic characteristics on simplified sunflower seed agar (SSA), and reaction with a commercial (Bichro-Dubli) latex agglutination test were also performed. The assay was further applied on 239 clinical yeast and yeast-like fungi and results were confirmed by DNA sequencing of internal transcribed spacer (ITS) region of rDNA.ResultsThe results of duplex PCR assay for 122 germ tube positive and 12 germ tube negative isolates of Candida species were comparable to their identification by Vitek 2 ID-YST system, colony characteristics on SSA and latex agglutination test. Application of duplex PCR also correctly identified all 148 C. albicans and 50 C. dubliniensis strains among 239 yeast-like fungi.ConclusionsThe data show that both, duplex PCR and Bichro-Dubli are reliable tests for rapid (within few hours) identification of clinical yeast isolates as C. dubliniensis or C. albicans. However, duplex PCR may be applied directly on clinical yeast isolates for their identification as C. dubliniensis or C. albicans as it does not require prior testing for germ tube formation or latex Candida agglutination.

Phylogenetic Relationships Matter: Antifungal Susceptibility among Clinically Relevant Yeasts

“…Additionally, when excluding the data for the two most frequent species, C. albicans and C. glabrata, in a sensitivity analysis, there were still significant differences between the three main PHYLO groups (A1Q6F, A1Q9A, A5Q7D) and for ITR (all had P values of Ͻ0.01) and FLC (all had P values of Ͻ0.002); the main message therefore remains. Although closely related isolates, e.g., C. albicans and C. dubliniensis, could be clearly separated (77,80) and showed a high probability of developing resistance to azoles (80)(81)(82), as reported in the literature, the MICs of C. dubliniensis may differ significantly (80). For example, despite the low numbers of C. dubliniensis isolates tested and the relatedness of C. dubliniensis to C. albicans, it could be demonstrated that C. dubliniensis, like other species, shows its own distinct group of susceptibility profiles.…”

Combination of Phenotypic Tests as a Screening Approach for the Differentiation of Cryptic Species Candida albicans and Candida dubliniensis

“…After extraction, DNA was quantified through Qubit™. The obtained DNA samples were subjected to PCR, according to the methodology described by Ahmad et al [8], using species-specific primers to amplify specific ITS1 and ITS2 regions of rDNA. For the identification of C. albicans, CALF (5'-3'TGGTAAGGCGGGATCGCTT) and CALR (5'GGTCAAAGTTTGAAGATATAC) primers were used.…”

“…albicans and C. dubliniensis are cryptic species and share several phenotypic characteristics, as germ tube formation and chlamydospore production, when grown on cornmeal agar [8]. Although some phenotypic characteristics slightly differ between these species, definite differentiation of C. albicans and C. dubliniensis relies on molecular methods [9,10].…”

Agreement between RAPD, API20C AUX, CHROMagar Candida and microculture on oral Candida identification

“…In recent decades, traditional methods of microorganism phenotyping have been replaced or added by the procedures associated to recombinant DNA [12][13][14] . Methods based on molecular markers are useful not only for phenotyping, but also for differentiation of Candida species [15][16] . The RAPD (Random Amplification Polymorphic DNA) allows the amplification of DNA sequences and is a simple and quick technique that does not require prior knowledge on the genomes to characterize organisms, using one randomly determined (usually a decamer) primer 17 .…”