PEAK3 pseudokinase represents a pro-migratory and -invasive signalling scaffold

Hou, Jianmei; Nguyen, Elizabeth V.; Surudoi, Minglyanna; Roy, Michael J; Patel, Onisha; Lucet, Isabelle S; Ma, Xiuquan; Daly, Roger J.

doi:10.1101/2021.02.17.431740

Cited by 2 publications

(4 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Since PYK2 is regulated by dimerization [ 26 ], its binding to PEAK3 might facilitate this activation mechanism. During the preparation of this manuscript, the Daly group reported a similar PEAK3 oncogenic function in breast epithelial cells and showed that PEAK3 tyrosine phosphorylation promotes GBR2 and ASAP1 binding [ 35 ], which is highly consistent with our proposed mechanism of PEAK3 oncogenic signaling.…”

Section: Discussionsupporting

confidence: 77%

“…Mechanistically, our findings support a tyrosine phosphorylation-dependent PEAK3 signaling implicating the TK PYK2 ( Figure S9 ). For instance, PEAK3 may act a scaffold to bring PYK2 and ASAP1 together for efficient ASAP1 tyrosine phosphorylation, enabling AKT signaling [ 33 , 34 , 35 ]. Moreover, our results suggest that PEAK3 activates PYK2 through a SHED-dependent mechanism, as previously reported for PEAK2 activation of CSK [ 8 ].…”

Section: Discussionmentioning

confidence: 99%

“…The pCDNA3.1-V5-PTK2B (PYK2) plasmid was a gift from Kai Johnsson (Addgene plasmid # 127233). The siRNAs were: 5′TTCTCCGAACGTGTCACGTTT3′ (siCTRL), 5′GTATAGCAACCTTGGTCAGAT 3′ (siPEAK3 also named siPEAK3 #1), GCGGGGACGCCCUGUAUUA (siPEAK3 #2), and GGUCAGCGUCUCCAUGAUA (siPEAK3 #3) [ 35 ].…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

SHED-Dependent Oncogenic Signaling of the PEAK3 Pseudo-Kinase

Ounoughene¹,

Fourgous²,

Boublik³

et al. 2021

Cancers

View full text Add to dashboard Cite

The PEAK1 and Pragmin/PEAK2 pseudo-kinases have emerged as important components of the protein tyrosine kinase pathway implicated in cancer progression. They can signal using a scaffolding mechanism that involves a conserved split helical dimerization (SHED) module. We recently identified PEAK3 as a novel member of this family based on structural homology; however, its signaling mechanism remains unclear. In this study, we found that, although it can self-associate, PEAK3 shows higher evolutionary divergence than PEAK1/2. Moreover, the PEAK3 protein is strongly expressed in human hematopoietic cells and is upregulated in acute myeloid leukemia. Functionally, PEAK3 overexpression in U2OS sarcoma cells enhanced their growth and migratory properties, while its silencing in THP1 leukemic cells reduced these effects. Importantly, an intact SHED module was required for these PEAK3 oncogenic activities. Mechanistically, through a phosphokinase survey, we identified PEAK3 as a novel inducer of AKT signaling, independent of growth-factor stimulation. Then, proteomic analyses revealed that PEAK3 interacts with the signaling proteins GRB2 and ASAP1/2 and the protein kinase PYK2, and that these interactions require the SHED domain. Moreover, PEAK3 activated PYK2, which promoted PEAK3 tyrosine phosphorylation, its association with GRB2 and ASAP1, and AKT signaling. Thus, the PEAK1-3 pseudo-kinases may use a conserved SHED-dependent mechanism to activate specific signaling proteins to promote oncogenesis.

show abstract

Section: Discussionsupporting

confidence: 77%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

SHED-Dependent Oncogenic Signaling of the PEAK3 Pseudo-Kinase

Ounoughene¹,

Fourgous²,

Boublik³

et al. 2021

Cancers

View full text Add to dashboard Cite

show abstract

“…One important question not addressed in our study is the mechanism of PEAK3 regulation. During the preparation of this manuscript, Daly et al reported a similar PEAK3 oncogenic function in breast epithelial cells and showed that PEAK3 tyrosine phosphorylation promotes GBR2 and ASAP1 binding (36). Although many upstream TKs, including SFKs, could phosphorylate PEAK3, our finding suggest that PYK2 phosphorylates PEAK3, like CSK phosphorylates PEAK2.…”

Section: Discussionmentioning

confidence: 49%

SHED-dependent oncogenic signalling of the PEAK3 pseudo-kinase

Ounoughene

Fourgous

Boublik

et al. 2021

Preprint

View full text Add to dashboard Cite

The PEAK1 and pragmin/PEAK2 pseudo-kinases have emerged as important components of the protein tyrosine kinase pathway implicated in cancer progression They can signal by a scaffolding mechanism that involves a conserved split helical dimerization (SHED) module. We recently identified PEAK3 as a novel member of this family based on structural homology; however, its signalling mechanism remains unclear. Here, we found that although it can self-associate, PEAK3 shows higher evolutionary divergence than PEAK1/2. Moreover, PEAK3 protein is strongly expressed in human haematopoietic cells, and is upregulated in acute myeloid leukaemia. Functionally, PEAK3 overexpression in U2OS sarcoma cells enhanced their growth and migratory properties, while its silencing in THP1 leukemic cells reduced these effects. Importantly, an intact SHED module was required for these PEAK3 oncogenic activities. Mechanistically, through a phosphokinase survey, we identified PEAK3 as a novel inducer of AKT signalling, independent of growth factor stimulation. Then, proteomic analyses revealed that PEAK3 interacts with the signalling proteins GRB2 and ASAP1/2 and the protein kinase PYK2, and that these interactions require the SHED domain. Moreover, PEAK3 activated PYK2 to promote AKT signalling. Thus, the PEAK1-3 pseudo-kinases may use a conserved SHED-dependent mechanism to activate specific signalling proteins to promote oncogenesis.

show abstract

PEAK3 pseudokinase represents a pro-migratory and -invasive signalling scaffold

Cited by 2 publications

References 37 publications

SHED-Dependent Oncogenic Signaling of the PEAK3 Pseudo-Kinase

SHED-Dependent Oncogenic Signaling of the PEAK3 Pseudo-Kinase

SHED-dependent oncogenic signalling of the PEAK3 pseudo-kinase

Contact Info

Product

Resources

About