Pcr Primers for the Amplification of Mitochondrial Small Subunit Ribosomal DNA of Lichen-forming Ascomycetes

Abstract

Four primers for the amplification of mitochondrial DNA of lichenforming ascomycetes are presented. The primers match the conserved regions U2, U4, and U6, respectively, of mitochondrial small subunit (SSU) ribosomal DNA (rDNA). Polymerase chain reaction using different combinations of the primers produced single amplification products from DNA of eight lichen-forming fungal species but did not amplify DNA of two axenic cultured algal species. The amplification product obtained from Lobaria pulmonaria was sequenced and the 894-bp sequence was compared with the mitochondrial SSU rDNA sequence of Podospora anserina. The two sequences revealed more than 76% identity in the conserved regions U3 to U5 demonstrating that we amplified mitochondrial DNA. The primers matching U2 and U6 yielded amplification products of 800-1000 bp depending on the species examined. The variation observed suggests that mitochondrial SSU rDNA may be useful for phylogenetic analyses of lichen-forming ascomycetes.

Hidden diversity in the morphologically variable script lichen (Graphis scripta) complex (Ascomycota, Ostropales, Graphidaceae)

“…Primers for amplification included (a) for mtSSU: mrSSU1 and mrSSU3R (Zoller et al 1999), (b) for nuLSU: AL2R ) and LR3 (Vilgalys and Hester 1990), and (c) for EF-1: EFdF and 1567R (Rehner 2001). For RPB2, we designed a set of primers to target samples of Graphidaceae: GD1-RPB2-7cF (forward: GAGCGAATGG ATACCATGGCGA) and GD-RPB2-11aR (reverse: GCTT ACGCCCGGTGTGACCATTGT).…”

Shackletonia cryodesertorum (Teloschistaceae, Ascomycota), a new species from the McMurdo Dry Valleys (Antarctica) with notes on the biogeography of the genus Shackletonia

“…The nuclear ribosomal large subunit (nrLSU) and the small subunit of the mitochondrial ribosomal RNA gene (mtSSU) were amplified from two out of four specimens, whereas the internal transcribed spacer region (nrITS) was sequenced for all specimens in a previous work (Pérez-Ortega et al 2012b). The primers used were LR3 and LR7 (Vilgalys and Hester 1990) for nrLSU, and mrSSU1 (Zoller et al 1999) and mrSSU7 (Zhou and Stanosz 2001) for mtSSU. The following PCR temperature profiles were employed: 5 min at 94°C, then 35 cycles of 1 min at 94°C, 1 min at 54 or 56°C (nrLSU, mtSSU, respectively), 3 min at 72°C, with a final extension of 10 min at 72°C.…”

Architrypethelium murisporum (Ascomycota, Trypetheliaceae), a remarkable new lichen species from Thailand challenging ascospore septation as an indicator of phylogenetic relationships

“…DNA amplification was performed for mitochondrial small subunit ribosomal DNA (mtSSU) and nuclear large subunit ribosomal DNA (nuLSU) using primer pairs mrSSU1 (Zoller et al 1999) with MSU7 (Zhou and Stanosz 2001) and LR0R with LR3 (Vilgalys and Hester 1990), respectively. PCR reaction mixture was prepared in a total volume of 50 μl, consisting of 5 μl of 10× Pfu Buffer with MgSO 4 , 2mM of dNTP mix, 20 μM of each primer, 1·25 U of Pfu DNA Polymerase (Thermo Fisher Scientific Inc.) and 5 μl of 1/10 dilution of DNA solution.…”