PCR detection of Klebsiella pneumoniae in infant formula based on 16S–23S internal transcribed spacer

Yin, Liang; Liu, Chao; Zheng, Wei; Zhang, Xia; Yu, Jia; Gao, Qili; Hou, Yanmei; Huang, Xi‐Tai

doi:10.1016/j.ijfoodmicro.2008.03.005

Cited by 115 publications

(89 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Results showed that the amplified fragments were 344 bp in size as shown in figure (1), which the same size is obtained by Park et al, (2011) In common with the findings of Liu et al, (2008), they found that K. pneumoniae failed to give this band in the PCR inclusion of the pehX primers. The pehX gene provided specific detection of K. oxytoca (Turton et al, 2010).…”

Section: Molecular Identification Of K Oxytocasupporting

confidence: 76%

Molecular Discrimination of Klebsiella oxytoca using Polymerase Chain Reaction Targeted Polygalacturonase (pehX) Gene

Zedan¹

2017

Int.J.Curr.Microbiol.App.Sci

View full text Add to dashboard Cite

Section: Molecular Identification Of K Oxytocasupporting

confidence: 76%

Molecular Discrimination of Klebsiella oxytoca using Polymerase Chain Reaction Targeted Polygalacturonase (pehX) Gene

Zedan¹

2017

Int.J.Curr.Microbiol.App.Sci

View full text Add to dashboard Cite

“…To detect Burkholderia DNA, we used the Burkholderia-specific forward and reverse primers CTGCG-AAAGCCGGAT and TGCCATACTCTAGCYYGC (57). To detect Klebsiella DNA, we used the Klebsiella-specific forward and reverse primers ATTTGAAGAG-GTTGCAAACGAT and CCGAAGATGTTTCACTTCTGATT (58). After PCR amplification, we ran 10 μL of each PCR on a 1% agarose gel with 0.1% ethidium bromide to image the presence or absence of bands.…”

Section: Evolution Pnas Plusmentioning

confidence: 99%

Burkholderia bacteria infectiously induce the proto-farming symbiosis of Dictyostelium amoebae and food bacteria

DiSalvo

Haselkorn

Bashir

et al. 2015

Proc. Natl. Acad. Sci. U.S.A.

104

239

View full text Add to dashboard Cite

Symbiotic associations can allow an organism to acquire novel traits by accessing the genetic repertoire of its partner. In the Dictyostelium discoideum farming symbiosis, certain amoebas (termed “farmers”) stably associate with bacterial partners. Farmers can suffer a reproductive cost but also gain beneficial capabilities, such as carriage of bacterial food (proto-farming) and defense against competitors. Farming status previously has been attributed to amoeba genotype, but the role of bacterial partners in its induction has not been examined. Here, we explore the role of bacterial associates in the initiation, maintenance, and phenotypic effects of the farming symbiosis. We demonstrate that two clades of farmer-associated Burkholderia isolates colonize D. discoideum nonfarmers and infectiously endow them with farmer-like characteristics, indicating that Burkholderia symbionts are a major driver of the farming phenomenon. Under food-rich conditions, Burkholderia-colonized amoebas produce fewer spores than uncolonized counterparts, with the severity of this reduction being dependent on the Burkholderia colonizer. However, the induction of food carriage by Burkholderia colonization may be considered a conditionally adaptive trait because it can confer an advantage to the amoeba host when grown in food-limiting conditions. We observed Burkholderia inside and outside colonized D. discoideum spores after fruiting body formation; this observation, together with the ability of Burkholderia to colonize new amoebas, suggests a mixed mode of symbiont transmission. These results change our understanding of the D. discoideum farming symbiosis by establishing that the bacterial partner, Burkholderia, is an important causative agent of the farming phenomenon.

show abstract

“…A PCR method based on ITS sequences has been developed for the detection and identification of K. pneumoniae subsp. pneumoniae (22,24 and tRNA Ala (UGC) genes]-were detected. The sequence and length polymorphisms of the ITS regions were analyzed.…”

mentioning

confidence: 99%

Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species

Wang

Cao

et al. 2008

J Clin Microbiol

Self Cite

View full text Add to dashboard Cite

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes.

show abstract

PCR detection of Klebsiella pneumoniae in infant formula based on 16S–23S internal transcribed spacer

Cited by 115 publications

References 19 publications

Molecular Discrimination of Klebsiella oxytoca using Polymerase Chain Reaction Targeted Polygalacturonase (pehX) Gene

Molecular Discrimination of Klebsiella oxytoca using Polymerase Chain Reaction Targeted Polygalacturonase (pehX) Gene

Burkholderia bacteria infectiously induce the proto-farming symbiosis of Dictyostelium amoebae and food bacteria

Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species

Contact Info

Product

Resources

About