PCR‐based Specific Detection of Ustilaginoidea virens and Ephelis japonica

Zhou, Yu; Izumitsu, Kosuke; Sonoda, R. M.; Nakazaki, Tetsuya; Tanaka, Eisaku; Tsuda, Mitsuya; Tanaka, Chihiro

doi:10.1046/j.1439-0434.2003.00761.x

Cited by 57 publications

(63 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The identity of the present seven isolates was confirmed through PCR test using the primers US1-5/US3-3 used earlier (Ladhalakshmi et al, 2012;Zhou et al, 2003;Zhou et al, 2008). The desired specific length of 380 bp bands was observed in all the seven isolate taken for the study.…”

Section: Specific Its Analysis and Sequencingmentioning

confidence: 53%

“…Pathogen identity was checked through polymerase chain reaction (PCR) analysis using U. virens-specific internal transcribed spacer (ITS) primer US 1-5/US3-3 (Zhou et al, 2003).…”

Section: Molecular Characterizationmentioning

confidence: 99%

“…The specific internal transcribed spacer (ITS) primers US1-5, Forward (CCGGAGGATACAACCAAAAAA ACTCT) and US3-3, Reverse (GCTCCAAGTGCGAGG ATAACTGAAT) were used for confirmation of U. virens (Zhou et al, 2003). The Polymerase Chain Reaction (PCR) mixture of 20 µl consisted of 10 pmol of each primer (US1-5/US3-3), dNTPs 2.5 mM, DNA template 20 ng and Taq polymerase 14.…”

Section: Ustilaginoidea Virens -Specific Internal Transcribed Spacer mentioning

confidence: 99%

See 2 more Smart Citations

Histopathological and Molecular Characterization of Ustilaginoidea virens in Rice

Kumari¹,

Sharma²

2017

View full text Add to dashboard Cite

Histopathological studies of false smut balls on rice spikelet were conducted through SEM and microtomy. Detection and identification of the fungal culture of Ustilaginoidea virens from infected host tissue was done through polymerase chain reaction (PCR) using U. virens specific internal transcribed spacer (ITS) primer. The primer amplified 380bp product.Keywords: False smut balls, microtomy, scanning electron microscopy, Ustilaginoidea virens RESEARCH ARTICLE *Corresponding author: kumaripooja2989@gmail.com False smut of rice is caused by Ustilaginoidea virens, teleomorphic stage is Villosiclava virens. Earlier it was considered as a minor disease of rice (Padwick, 1950;Tanaka et al., 2008) and considered to be a sign of 'bumper harvest'of the crop. False smut balls on rice panicles are the typical symptom of the disease (Pooja et al., 2015). False smut balls are intertwined with the mycelium of U. virens at early stage and then chlamydospores are formed. The chlamydospores are initially smooth and later become warty at maturity (Kim and Park, 2007;Mathew and Sharma, 2015). Under bright-field light microscopy, the conidia are elliptical and warty on the surface with diameters ranging from 2 to 6 µm. In scanning electron microscopic study the conidia appeared to be globose to irregularly rounded and ornamented with prominent spines. The spines are either pointed or slightly curved at the apex and approximately 200-550 nm long. In transmission electron microscopy, both the spined conidia and hyphae along with lipid globules and vacuoles were seen in the cytoplasm of host cell.The stigma, ovary, and even the young grains of the rice were assumed to be the site of primary infection (Padwick, 1950;Wang, 1992), but subsequently histological observation showed that the pathogen can attack the root of the rice plant at the seedling stage and may colonise symptomlessly in the entire plant (Schroud and TeBeest, 2005;TeBeest, 2010). The fungal life cycle of U. virens and primary infection site on the paddy crop in nature is still very unclear. SEM and TEM study of the ultrathin sections of false smut balls and colonies of U. virens on different media showed that the dense chlamydospores are piled around the inner hyphae. The fungal hyphae and endosperm were not distinguishable.Large stretch of well-developed endosperm was present in the center which was filled with large amount of starch grains. This suggests that the infection of pathogen may also occur in host plant after the flowering and grouting, and the fungal pathogen may be saprophytic in nature. The aim of the present study was to find out the nature of the disease in plants. MATERIALS AND METHODS Spore observationChlamydospores of U. virens were assessed for their variation using compound and scanning electron microscope. Compound microscopeFungal spores were placed over the cleaned glass-slide having a drop of distilled water using a needle and covered with a cover slip and viewed under the compound microscope under 40X and oil immersion at 100X. ...

show abstract

Section: Specific Its Analysis and Sequencingmentioning

confidence: 53%

“…Pathogen identity was checked through polymerase chain reaction (PCR) analysis using U. virens-specific internal transcribed spacer (ITS) primer US 1-5/US3-3 (Zhou et al, 2003).…”

Section: Molecular Characterizationmentioning

confidence: 99%

Section: Ustilaginoidea Virens -Specific Internal Transcribed Spacer mentioning

confidence: 99%

See 1 more Smart Citation

Histopathological and Molecular Characterization of Ustilaginoidea virens in Rice

Kumari¹,

Sharma²

2017

View full text Add to dashboard Cite

show abstract

“…Isolation on nutrient-rich media and morphological examinations are the conventional detection and identification methods for U. virens (Zhou et al, 2003). However, these procedures are time consuming and nonspecific.…”

Section: Introductionmentioning

confidence: 99%

“…Conventional polymerase chain reaction (PCR) and nested-PCR techniques can qualitatively detect U. virens. Because of the use of two pairs of amplification primers, the nested-PCR assay has higher sensitivity and specificity than the conventional single-round PCR assay (Zhou et al, 2003). However, it is difficult to quantify the amount of DNA by the conventional PCR or nested-PCR assay.…”

Section: Introductionmentioning

confidence: 99%

Quantitative detection of the rice false smut pathogen Ustilaginoidea virens by real-time PCR

Li¹,

Ni²,

Duan³

et al. 2013

Genet. Mol. Res.

View full text Add to dashboard Cite

ABSTRACT. Rice false smut (RFS) is an important rice disease that is caused by the pathogen Ustilaginoidea virens. In this study, we developed a real-time polymerase chain reaction (PCR) assay to detect U. virens and to estimate the level of disease. The genomic DNAs of U. virens and rice were extracted together from the rice samples. Real-time PCR assays were performed and compared to conventional nested-PCR assays. The realtime PCR assay presented a consistent linearity of the standard curve (R 2 = 0.9999). The detection limit could be as low as 40 fg U. virens DNA with a rice genomic DNA background on using the real-time PCR assay, which showed significantly higher sensitivity than the conventional nested-PCR assay. We conclude that the real-time PCR quantitative assay is a useful tool for detecting U. virens and for early defense and control of RFS.

show abstract

Detection and Identification of Fungal Pathogens

2017

Microbial Plant Pathogens

View full text Add to dashboard Cite

PCR‐based Specific Detection of Ustilaginoidea virens and Ephelis japonica

Cited by 57 publications

References 14 publications

Histopathological and Molecular Characterization of <I>Ustilaginoidea virens</I> in Rice

Histopathological and Molecular Characterization of <I>Ustilaginoidea virens</I> in Rice

Quantitative detection of the rice false smut pathogen Ustilaginoidea virens by real-time PCR

Detection and Identification of Fungal Pathogens

Contact Info

Product

Resources

About