PCR‐based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS‐specific primers

Mmbaga, Margaret T.; Klopfenstein, Ned B.; Kim, M. S.; Mmbaga, N. C.

doi:10.1111/j.1439-0329.2004.00374.x

Cited by 13 publications

(10 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Therefore, the classical morphological criteria and host range data used in identification (Braun et al., 2002) can now be supplemented with molecular methods. Although two ITS primer pairs that distinguished E. pulchra from P. guttata at the anamorph stage have been reported (Mmbaga et al., 2004), our further studies showed the two identified ITS primer pairs were not species‐specific for the two pathogens. The objective of the present work was to develop species‐specific primers for easy detecting and distinguishing the two fungi, P. guttata and E. pulchra causing powdery mildews in dogwood.…”

Section: Introductioncontrasting

confidence: 62%

“…Considering the limitations of small sample sizes, this specific detection method will be further evaluated on a large scale to survey P. guttata and E. pulchra in dogwood. Previously reported ITS primers for E. pulchra , EP1/EP2 and for P. guttata , PG1/PG2 (Mmbaga et al., 2004) did not produce unique PCR band for E. pulchra or P. guttata . The reason may be that the primer EP1 was not a specific primer to E. pulchra and its sequence can be found in other organisms such as Adenia mannii or Phellinus robiniae .…”

Section: Discussionmentioning

confidence: 82%

“…The new ITS primers were then evaluated on E. pulchra , P. guttata and C. florida host using standard PCR procedures described above. The previously reported ITS primers for E. pulchra , EP1 (5′‐GTGAACCTGCGGAAGATC‐3′, forward) and EP2 (5′‐CATGTGACTGGAACAAAAAG‐3′, reverse), and for P. guttata , PG1 (5′‐CTGAGCGTGAAGACTCTC‐3′, forward), and PG2 (5′‐GGTATCCCTACCTGATTC‐3′, reverse) (Mmbaga et al., 2004) were also included in the primer evaluations.…”

Section: Methodsmentioning

confidence: 99%

“…Powdery mildew is one of the most economically important fungal diseases of flowering dogwood causing leaf damage and reducing plant growth (Hartman, 1998; Mmbaga, 1998). Two pathogens, Phyllactinia guttata and Erysiphe pulchra , have been associated with this disease (Klein et al., 1998; Braun and Takamatsu, 2000; Braun et al., 2002; Mmbaga et al., 2004). Conidia of powdery mildew fungi are wind‐dispersed from susceptible hosts to other plants (Brown and Hovmeøller, 2002).…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Differentiation of Two Pathogens of Powdery Mildew Disease in Flowering Dogwood (Cornus florida) by PCR‐mediated Method Based on ITS Sequences

Shi¹,

Kantartzi²,

Mmbaga³

et al. 2009

Journal of Phytopathology

View full text Add to dashboard Cite

Two fungi, Phyllactinia guttata and Erysiphe pulchra were identified as the pathogens of powdery mildew of flowering dogwood (Cornus florida). The objective of this research was to identify and distinguish the two fungi by developing species-specific primers. The internal transcribed spacer (ITS) universal primers and a series of species-specific primers designed from the ITS regions were used to evaluate and validate the two fungi causing powdery mildew in dogwood. Four primer pairs showed specificity to P. guttata and three to E. pulchra. These species-specific primer pairs can be used as molecular markers to provide diagnostic tools for detection and differentiation of the two powdery mildew pathogens in flowering dogwood.

show abstract

Section: Introductioncontrasting

confidence: 62%

Section: Discussionmentioning

confidence: 82%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Differentiation of Two Pathogens of Powdery Mildew Disease in Flowering Dogwood (Cornus florida) by PCR‐mediated Method Based on ITS Sequences

Shi¹,

Kantartzi²,

Mmbaga³

et al. 2009

Journal of Phytopathology

View full text Add to dashboard Cite

show abstract

“…For the Phyllactinia species, the PG 1 /PG 2 primers already described in the literature (Mmbaga et al, 2004) for the amplification of P. guttata from Cornus were used, since we checked from sequence alignments that they could amplify the sequence of Phyllactinia obtained in our previous study (Mougou et al, 2008). For the Erysiphe species, the three ITS sequences corresponding to E. alphitoides, E. hypophylla and E. quercicola were aligned, and the PRIMER 3 software (Rozen and Skaletsky, 2000) was used to design primer sets in the variable regions.…”

Section: Detection Of Oak Powdery Mildew Its Typesmentioning

confidence: 99%

Spatial distribution of lineages of oak powdery mildew fungi in France, using quick molecular detection methods

Mougou‐Hamdane

Giresse²,

Dutech

et al. 2010

Ann. For. Sci.

View full text Add to dashboard Cite

Abstract• Powdery mildew is a major fungal disease of oaks in Europe. Recent studies using internal transcribed spacer (ITS) sequences suggested the presence of four different lineages (putative species). The objective of the study was to investigate the spatial distribution of these lineages/species and, in particular, to test the hypothesis of a spatial differentiation, at various scales: regional (France), altitudinal (a Pyrenean transect) and local (within a forest plot).• Detection methods for the four ITS types were developed: (1) single strand conformation polymorphism analysis (SSCP); (2) PCR amplifications, for which specific primers were designed. SSCP proved to be efficient for the detection of Erysiphe alphitoides and E. quercicola types. In contrast, the rarer ITS types corresponding to E. hypophylla and Phyllactinia guttata (sensu lato) were only detected by specific amplification.• The study confirmed the strong predominance of the ITS sequence associated with E. alphitoides at all spatial scales (with a frequency higher than 80%). Isolates presumably belonging to E. quercicola (i.e. with same ITS type), a recently described species not yet recorded in Europe, were also found in all French regions at a significant frequency (15% at national level).• No pattern of spatial differentiation between the putative species could be demonstrated: E. alphitoides was often found in association with different ITS types in the same region, the same tree, and even in the same lesion. Mots-clés :Erysiphe alphitoides / Erysiphe quercicola / espèces sryptiques / Erysiphales / ITS / invasion biologique Résumé -Distribution spatiale de lignées d'oïdium des chênes en France analysée à l'aide d'outils rapides de caractérisation moléculaire.• L'oïdium est l'une des maladies fongiques les plus importantes sur chênes en Europe. Des études récentes basées sur l'internal transcribed spacer (ITS) ont suggéré l'implication de quatre lignées (espèces putatives) différentes. L'objectif de l'étude était de caractériser la distribution spatiale de ces lignées/espèces et en particulier de tester l'hypothèse d'une différenciation spatiale à plusieurs échelles : régionale (France), altitudinale (transect pyrénéen) et locale (au sein d'une parcelle forestière).• Des méthodes de détection des quatre types d'ITS ont été développées : (1) analyse SCCP ; (2) amplification par PCR de l'ITS par des amorces spécifiques. La SSCP a permis de détecter facilement les ITS correspondant à E. alphitoides et E. quercicola. Par contre, les ITS plus rares correspondant à E. hypophylla et Phyllactinia guttata (sensu lato) n'ont été détectés que par amplification spécifique.• L'étude a confirmé la forte prédominance (avec une fréquence supérieure à 80 %) de la séquence d'ITS associée à E. alphitoides. Les isolats présentant la même séquence d'ITS qu'E. quercicola, espèce récemment décrite et encore non mentionnée en Europe, ont également été retrouvés dans toutes les régions françaises à une fréquence importante (15 % en moyenne pour l'échantillonnage...

show abstract

Ecological genomics of local adaptation inCornus floridaL. by genotyping by sequencing

Pais

Whetten

Xiang

2016

Ecology and Evolution

View full text Add to dashboard Cite

Discovering local adaptation, its genetic underpinnings, and environmental drivers is important for conserving forest species. Ecological genomic approaches coupled with next‐generation sequencing are useful means to detect local adaptation and uncover its underlying genetic basis in nonmodel species. We report results from a study on flowering dogwood trees (Cornus florida L.) using genotyping by sequencing (GBS). This species is ecologically important to eastern US forests but is severely threatened by fungal diseases. We analyzed subpopulations in divergent ecological habitats within North Carolina to uncover loci under local selection and associated with environmental–functional traits or disease infection. At this scale, we tested the effect of incorporating additional sequencing before scaling for a broader examination of the entire range. To test for biases of GBS, we sequenced two similarly sampled libraries independently from six populations of three ecological habitats. We obtained environmental–functional traits for each subpopulation to identify associations with genotypes via latent factor mixed modeling (LFMM) and gradient forests analysis. To test whether heterogeneity of abiotic pressures resulted in genetic differentiation indicative of local adaptation, we evaluated F st per locus while accounting for genetic differentiation between coastal subpopulations and Piedmont‐Mountain subpopulations. Of the 54 candidate loci with sufficient evidence of being under selection among both libraries, 28–39 were Arlequin–BayeScan F st outliers. For LFMM, 45 candidates were associated with climate (of 54), 30 were associated with soil properties, and four were associated with plant health. Reanalysis of combined libraries showed that 42 candidate loci still showed evidence of being under selection. We conclude environment‐driven selection on specific loci has resulted in local adaptation in response to potassium deficiencies, temperature, precipitation, and (to a marginal extent) disease. High allele turnover along ecological gradients further supports the adaptive significance of loci speculated to be under selection.

show abstract

PCR‐based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS‐specific primers

Cited by 13 publications

References 10 publications

Differentiation of Two Pathogens of Powdery Mildew Disease in Flowering Dogwood (Cornus florida) by PCR‐mediated Method Based on ITS Sequences

Differentiation of Two Pathogens of Powdery Mildew Disease in Flowering Dogwood (Cornus florida) by PCR‐mediated Method Based on ITS Sequences

Spatial distribution of lineages of oak powdery mildew fungi in France, using quick molecular detection methods

Ecological genomics of local adaptation inCornus floridaL. by genotyping by sequencing

Contact Info

Product

Resources

About