PC cell-derived growth factor (PCDGF/GP88, progranulin) stimulates migration, invasiveness and VEGF expression in breast cancer cells

Tangkeangsirisin, Wisit; Serrero, Ginette

doi:10.1093/carcin/bgh171

Cited by 116 publications

(114 citation statements)

References 36 publications

Supporting

Mentioning

107

Contrasting

Order By: Relevance

“…37,38 The ectopic expression of GRN promotes cancer cells invasiveness and forms large tumors in nude mice, whereas GRN expression depletion diminishes tumor growth and cell proliferation. 39 This study demonstrates downexpression of Id-1 in gastric cancer cells after sulindac sulfide administration. To our knowledge, this is the first report.…”

Section: Discussionmentioning

confidence: 61%

Id-1gene downregulation by sulindac sulfide and its upregulation during tumor development in gastric cancer

2005

View full text Add to dashboard Cite

The molecular mechanisms underlying the chemopreventive effects of NSAIDs are not well understood and remain the subject of debate. One of the mechanistic possibilities involves alterations in gene expression. We examined gene expression profiles in SNU601 gastric cancer cells treated with sulindac sulfide (50 lM) for 24 hr. Microarray analysis showed that 1.3% (105/8170) of genes were induced or repressed more than 3-fold in cells treated with sulindac sulfide. Seven genes were selected and confirmed by reverse transcription-polymerase chain reaction. Inhibitor of differentiation/DNA binding-1 (Id-1) was downregulated in SNU601 cells treated with sulindac sulfide. Id-1 expression level was decreased dose-dependently by sulindac sulfide. In addition, the expression pattern of Id-1 was inversely related to that of nm23. We also examined Id-1 expression in human gastric cancer tissues and compared it with clinicopathologic parameters to study its biologic role in the cancers. Id-1 was frequently and strongly expressed in gastric cancer tissues compared with that in adjacent nonmetaplastic mucosa. Its immunoreactivity scores were positively correlated to Ki67 labeling indices and tumor progression, and is higher in intestinal type than in diffuse type. In summary, a number of genes, both induced and repressed, could be important in mediating sulindac sulfide-induced cell death in gastric cancer cells. Id-1, one of the repressed genes, is upregulated in gastric cancers and has positive role in tumor progression and histogenesis of intestinal-type cancers. ' 2005 Wiley-Liss, Inc.

show abstract

Section: Discussionmentioning

confidence: 61%

Id-1gene downregulation by sulindac sulfide and its upregulation during tumor development in gastric cancer

2005

View full text Add to dashboard Cite

show abstract

“…(9,19) Each of these actions requires the activity of the ERK and PI3K signal transduction pathways, although the extent to which either pathway contributes is variable. (16) If PGRN promotes tumor growth as we propose here, blocking its action should block tumor growth.…”

Section: Progranulin In Cancermentioning

confidence: 99%

“…(25) Treating cancers in mice is far from treating people, but the liver cancer experiments show that PGRN has potential as a cancer drug target and is an extremely promising area for future investigation. Interestingly, the PGRN monoclonal antibodies not only inhibited proliferation of the cancer cells directly, but also had a striking anti-angiogenic action, (25) possibly due to decreased secretion of the angiogenic growth factor VEGF in the treated tumors, (19) although given that PGRN stimulated angiogenesis in wounds, (28) a more direct effect on tumor vascularization can be postulated.…”

Section: Progranulin In Cancermentioning

confidence: 99%

“…(6,7) The role of PGRN in cancer has been repeatedly demonstrated. (8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20)(21)(22)(23)(24)(25)(26) PGRN has been invoked in early embryogenesis, (27) wound repair, and inflammation. (28)(29)(30) These are diverse roles, extending from control of embryonic development during the first days of life to the survival of long-lived post-mitotic neurons of the adult brain.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

The granulin gene family: from cancer to dementia

2009

View full text Add to dashboard Cite

The growth factor progranulin (PGRN) regulates cell division, survival, and migration. PGRN is an extracellular glycoprotein bearing multiple copies of the cysteine-rich granulin motif. With PGRN family members in plants and slime mold, it represents one of the most ancient of the extracellular regulatory proteins still extant in modern animals. PRGN has multiple biological roles. It contributes to the regulation of early embryogenesis, to adult tissue repair and inflammation. Elevated PGRN levels often occur in cancers, and PGRN immunotherapy inhibits the growth of hepatic cancer xenografts in mice. Recent studies have demonstrated roles for PGRN in neurobiology. An autosomal dominant mutation in GRN, the gene for PGRN, leads to neuronal atrophy in the frontal and temporal lobes, resulting in the disease frontotemporal lobar dementia. In this review we will discuss current knowledge of the multifaceted biology of PGRN.

show abstract

“…A total of 30 -35 PCR cycles depending on the gene amplified was performed, followed by electrophoresis on 1% agarose gel. Specific primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) for bcl-2 and for V-EGF have been previously described [31] [36] .Other specific primers used here were: for bax: forward primer 5' GAGCAGATCATGAAGACAGGGG 3', reverse primer 5' CTCCAGCAAGGCCCAGCGTC 3'; for bcl-x L : forward primer 5' CAGTGAGTGAGCAGGTGTTTTGG 3', reverse primer 5' GTTCCACAAAAGTATCCCAGCCG 3';…”

Section: Determination Of Mrna Expression For Bcl-2 Bcl-xl Bax and mentioning

confidence: 99%

GP88 (Progranulin) Confers Fulvestrant (Faslodex, ICI 182,780) Resistance to Human Breast Cancer Cells

Tangkeangsirisin¹,

Serrero²

2014

ABCR

View full text Add to dashboard Cite

The 88 kDa glycoprotein known as GP88, Progranulin or PC cell derived growth factor is an autocrine growth factor with a unique cysteine rich motif that is over expressed in breast cancer whereas it is negative in normal mammary epithelial cells. It has been shown to play a major role in estrogen independence, tamoxifen resistance and tumorigenesis of breast cancer cells. In the present study, we investigated the effect of GP88 overexpression on the response of the human breast cancer MCF-7 cells to the pure estrogen receptor antagonist fulvestrant (ICI 182,780). While fulvestrant effectively inhibited cell proliferation of empty vector transfected cells, it had no inhibitory effect on the proliferation of GP88 overexpressing breast cancer cells. Mouse xenograft experiments in athymic ovariectomized nude mice showed that GP88 over expressing cells were fulvestrant resistant in vivo in contrast to low GP88 expressing cells. We show that the ability of fulvestrant to induce apoptosis determined by measuring cleavage of poly (ADP-ribose) polymerase was inhibited by GP88. Anti-apoptotic activity of GP88 was associated with sustained expression of bcl-2 and bcl-xL after fulvestrant treatment. In contrast, fulvestrant was still able to inhibit the ability of estrogen to stimulate ERE-luciferase reporter gene activity as well as vEGF expression in GP88 over expressing MCF-7 cells similarly to control MCF-7 cells. Collectively, our data suggest that GP88 prevents apoptosis induced by faslodex and contributes to antiestrogen resistance in human breast cancer.

show abstract

PC cell-derived growth factor (PCDGF/GP88, progranulin) stimulates migration, invasiveness and VEGF expression in breast cancer cells

Cited by 116 publications

References 36 publications

Id-1gene downregulation by sulindac sulfide and its upregulation during tumor development in gastric cancer

Id-1gene downregulation by sulindac sulfide and its upregulation during tumor development in gastric cancer

The granulin gene family: from cancer to dementia

GP88 (Progranulin) Confers Fulvestrant (Faslodex, ICI 182,780) Resistance to Human Breast Cancer Cells

Contact Info

Product

Resources

About