pBAM1: an all-synthetic genetic tool for analysis and construction of complex bacterial phenotypes

Abstract

BackgroundSince publication in 1977 of plasmid pBR322, many breakthroughs in Biology have depended on increasingly sophisticated vector platforms for analysis and engineering of given bacterial strains. Although restriction sites impose a certain format in the procedures for assembling cloned genes, every attempt thus far to standardize vector architecture and nomenclature has ended up in failure. While this state of affairs may still be tolerable for traditional one-at-a-time studies of single genes, the onset of systems and synthetic biology calls for a simplification -along with an optimization- of the currently unwieldy pool of genetic tools.ResultsThe functional DNA sequences present in the natural bacterial transposon Tn5 have been methodically edited and refactored for the production of a multi-purpose genetic tool named pBAM1, which allows a range of manipulations in the genome of Gram-negative bacteria. This all-synthetic construct enhances the power of mini-transposon vectors for either de-construction or re-construction of phenotypes á la carte by incorporating features inspired in systems engineering: modularity, re-usability, minimization, and compatibility with other genetic tools. pBAM1 bears an streamlined, restriction site-freed and narrow-host range replication frame bearing the sequences of R6K oriV, oriT and an ampicillin resistance marker. These go along with a business module that contains a host-independent and hyperactive transposition platform for in vivo or in vitro insertion of desired DNA into the genome of the target bacterium. All functional sequences were standardized for a straightforward replacement by equivalent counterparts, if required. pBAM1 can be delivered into recipient cells by either mating or electroporation, producing transposon insertion frequencies of 1.8 × 10-3 and 1.02 × 10-7, respectively in the soil bacterium Pseudomonas putida. Analyses of the resulting clones revealed a 100% of unique transposition events and virtually no-cointegration of the donor plasmid within the target genome.ConclusionsThis work reports the design and performance of an all-synthetic mini-transposon vector. The power of the new system for both identification of new functions or for the construction of desired phenotypes is shown in a genetic survey of hyper-expressed proteins and regulatory elements that influence the expression of the σ54-dependent Pu promoter of P. putida.

A standardized workflow for surveying recombinases expands bacterial genome‐editing capabilities

“…An adaptability to a myriad of harsh conditions has made P. putida a popular focus of biosynthetic studies aimed at industrial biotransformations as well as soil and water bioremediation (Garmendia et al ., 2008; Puchałka et al ., 2008; Poblete‐Castro et al ., 2012; Loeschcke and Thies, 2015). Unfortunately, the collection of genetic tools available in Pseudomonads is limited in scope and, when used in conjunction, is subject to bottlenecks that hinder the generation of a biotechnological chassis (Martínez‐García and de Lorenzo, 2011; Martínez‐García et al ., 2011, 2014). Efforts at recombineering in Pseudomonas species have been attempted with limited results (Liang and Liu, 2010; Swingle et al ., 2010).…”

A New Large-DNA-Fragment Delivery System Based on Integrase Activity from an Integrative and Conjugative Element

“…The most sophisticated systems are perhaps the miniTn7 and mini-Tn5 vectors, which, however, are limited to delivering relatively short DNA fragments (Ͻϳ10 kb) into the target chromosome with and without site specificity, respectively (1,16,25). Integration-proficient plasmids carrying a modified gene for ⌽CTX integrase, which also belongs to the tyrosine recombinase family, have been developed for engineering P. aeruginosa PAO1 (26).…”

Transcription factor levels enable metabolic diversification of single cells of environmental bacteria

“…First, a NotI DNA segment bearing an expression construct lacI q /Ptrc → xylR was excised from plasmid pVTR-XylR plasmid (Perez-Martin and de Lorenzo, 1996) and cloned in the corresponding site of the mini-Tn7-Gm delivery vector pTn7-M (Zoebel et al, 2015), resulting in plasmid pIB. The thereby assembled mini-Tn7 [L-Gm lacI q /Ptrc → xylR-R] transposon was then delivered to the chromosome of strain P. putida [Pu-GFP] (Garmendia et al, 2008) as explained in (de Lorenzo et al, 1990;Martínez-García et al, 2011;. This target strain is a plasmid-less P. putida KT2440 specimen bearing a chromosomal Pu-GFP fusion inserted with a mini-Tn5 transposon vector (de Lorenzo et al, 1990;Martínez-García et al, 2011;.…”

“…The thereby assembled mini-Tn7 [L-Gm lacI q /Ptrc → xylR-R] transposon was then delivered to the chromosome of strain P. putida [Pu-GFP] (Garmendia et al, 2008) as explained in (de Lorenzo et al, 1990;Martínez-García et al, 2011;. This target strain is a plasmid-less P. putida KT2440 specimen bearing a chromosomal Pu-GFP fusion inserted with a mini-Tn5 transposon vector (de Lorenzo et al, 1990;Martínez-García et al, 2011;. To verify the correct insertion of mini-Tn7 [L-Gm lacI q /Ptrc → xylR-R] into the att locus of P. putida [Pu-GFP] we selected some Gm R clones amplified diagnostic segments by PCR using primer combinations 5-Pput-glmS UP (5′AGTCAGAGTTACGGAATTGT AGG3′) with 3-Tn7L (5′ATTAGCTTACGACGCTAC ACCC3′) and 5-PpuglmS DOWN (5′TTACGTGG CCG TGCTAAAGGG3′) with 3-Tn7R (5′CACAGC ATA ACTGGACTGATTTC3′) and the products of amplification having a size of 400 and 200bp, respectively (Schweizer, 2001;Choi et al, 2005;Choi and Schweizer, 2006).…”