Pathways of internalization of the hCG/LH receptor: immunoelectron microscopic studies in Leydig cells and transfected L-cells.

By using a yeast two-hybrid screen we identified GIPC (GAIP-interacting protein C terminus), a protein with a type I PDZ domain as a novel human lutropin receptor (hLHR) binding partner. Pull-down and immunoprecipitation assays confirmed this interaction and showed that it is dependent on the PDZ domain of GIPC and the C-terminal tetrapeptide of the hLHR. To characterize the functional consequences of the GIPC-hLHR interaction, we used a small interfering RNA against GIPC to generate a clonal cell line that is deficient in GIPC. Studies with this cell line reveal that GIPC is partially responsible for the recycling of the hormone that is internalized by the hLHR and also for maintaining a relatively constant level of hLHR at the cell surface during hormone internalization.

Section: Resultsmentioning

confidence: 99%

GIPC Binds to the Human Lutropin Receptor (hLHR) through an Unusual PDZ Domain Binding Motif, and It Regulates the Sorting of the Internalized Human Choriogonadotropin and the Density of Cell Surface hLHR

Hirakawa

Galet

Kishi

et al. 2003

“…The sequence of a selected clone was verified and the plasmid was co-transfected with pRSV neo into human embryonic kidney (HEK 293) cells by the calcium phosphate precipitation method. Clonal cell lines expressing EE-Hm1 sites were selected in Dulbecco's modified Eagle's medium/H-16/F-12 with 10% fetal calf serum, 1% penicillin/streptomycin, and 400 mg/ml G418 in 5% CO 2 Receptor Binding Assay-Cells were seeded onto 12-well dishes, allowed to attach overnight, and then treated for specified times with 1 mM carbachol or buffer in incomplete medium at 37°C. Cells were placed on ice, washed three times with ice-cold PBS, and incubated with 1.5-2.0 nM [ 3 H]NMS at 12°C for 90 min.…”

Section: Methodsmentioning

confidence: 99%

“…An epitope tag with the sequence EYMPME was added to the aminoterminal of the receptor using the polymerase chain reaction. 2 The 5Ј primer with sequence TGAATTCACCATGGAATACATGCCAATG-GAAAACACTTCAGCCCCACCTGCTGTC was synthesized which contained the following components: an EcoRI restriction site, a 3Ј-nucleotide spacer, an initiating methionine, the sequence coding for the tag, and a portion of Hm1 sequence. The 3Ј primer with sequence TTG-GCGCCTGCTCGGTTCTCTGTCTCCCGGTA contained a BamHI restriction site.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Human Muscarinic Cholinergic Receptor Hm1 Internalizes via Clathrin-coated Vesicles

Tolbert

Lameh

1996

The mechanism by which muscarinic receptors internalize upon agonist exposure is poorly understood. To determine the endocytic pathways responsible for muscarinic receptor internalization, we have stably transfected human embryonic kidney (HEK 293) cells with the Hm1 (human muscarinic subtype 1) receptor tagged at the amino terminus with the epitope EYMPME. The subcellular location of the receptor was visualized by immunofluorescence confocal microscopy and quantified with the use of binding studies. The receptor redistributed into intracellular compartments following agonist treatment. This process was reversible upon removal of agonist and inhibited by antagonist. Acid treatment of the cells, which disrupts internalization via clathrin-coated vesicles, inhibited carbachol-stimulated internalization. Phorbol 12-myristate 13-acetate, on the other hand, which inhibits caveolae-mediated endocytosis, had no effect on carbachol-induced endocytosis. Double-labeling confocal microscopy was used to characterize the intracellular vesicles containing Hm1 receptor following agonist treatment. The Hm1 receptor was shown to be colocalized with clathrin and ␣-adaptin, a subunit of the AP2 adaptor protein which links endocytosed proteins with clathrin in the intracellular vesicles. In addition, endosomes containing Hm1 also contained the transferrin receptor, which internalizes via clathrin-coated vesicles. In contrast, caveolin, the protein that comprises caveolae, did not colocalize with Hm1 in intracellular vesicles following agonist treatment, indicating that caveolae are not involved in the agonist-induced internalization of Hm1. These results indicate that agonist-induced internalization of the Hm1 receptor occurs via clathrin-coated vesicles in HEK cells.Upon agonist treatment, many cell surface receptors undergo endocytosis into compartments inaccessible to extracellular ligands. This process is known as receptor internalization. The mechanism of internalization and its role in receptor regulation and function are largely unknown. Internalization may be a possible mechanism of receptor desensitization (i.e. reduction in agonist-induced activity), or alternatively, as recently suggested by Pippig et al.(1), resensitization. The endocytosed receptors may be either recycled back to the cell surface (2) or transported to lysosomes where receptors are subsequently degraded (2), a process known as receptor downregulation.Cell surface proteins may internalize into clathrin-coated vesicles (3), caveolae (4), or noncoated vesicles (5, 6). Little is known about the mechanism of internalization for the family of G protein-coupled receptors. Studies thus far suggest that the mechanism may vary with the receptor type. Raposo et al. (7) showed that noncoated vesicles appear to be involved in the endocytosis of muscarinic receptors in CCL137 fibroblast cells. On the other hand, Silva et al. (8) have shown muscarinic receptor activity in purified clathrin-coated vesicles from bovine brain. Using electron microscopy, ␤ 2 -adrenorecep...

“…This treatment did not change the rate of synthesis of the receptor (data not shown). Thus G s activation may modify the turn-over rate of the receptor, possibly by diverting some of the internalized receptor from the lysozymal degradation pathway (17) to the transcytotic pathway.…”

Section: Effect Of Brefeldin a And Effectors Of Trimeric G Proteins Omentioning

confidence: 99%

Basolateral Localization and Transcytosis of Gonadotropin and Thyrotropin Receptors Expressed in Madin-Darby Canine Kidney Cells

Beau

Misrahi

Gross

et al. 1997

؊ and cholera toxin. G s activation provoked a similar effect on LH receptor distribution in MDCK cells, whereas it did not modify the compartmentalization of the TSH receptor. Hormone-specific transcytosis was observed in MDCK cells expressing the gonadotropin (FSH and LH) receptors and was increased after cholera toxin administration.The gonadotropin (LH 1 and FSH) and thyrotropin (TSH) receptors belong to the large family of G-protein-coupled receptors (1-4). They possess the distinctive seven transmembrane spanning domains. However, they form a specific subgroup characterized by the presence of a large extracellular domain constituted by the repetition of leucine-rich motif (5). This ectodomain is responsible for the high affinity hormone binding (6 -9). Gonadotropin and TSH receptors are mainly coupled to G s and thus activate adenylate cyclase. The same receptors are also able to activate phospholipase C at high hormone concentrations. Mutations of the receptors have been described leading either to their constitutive activation (10 -12) or in contrast to a loss of receptor function (13)(14)(15).Little is known about the cellular trafficking of G-proteincoupled receptors in general and of this subgroup of receptors in particular. Ultrastructural immunocytochemistry has been used to analyze the internalization mechanisms of some receptors (16 -18). LH receptor-driven hormone transcytosis was observed through endothelial cells of testicular blood vessels (19). Recently immunocytochemistry using specific monoclonal antibodies demonstrated the basolateral distribution of the TSH receptor in thyroid cells (20) and of the FSH receptor in Sertoli cells (21), whereas the LH receptor was present all over the cell surface of thecal, granulosa, and luteal cells in the ovary and Leydig cells in the testes (22,23).The question was thus raised as to whether these differences in cellular distribution were due to differences in the structure of receptors or simply secondary to the fact that thyroid follicular cells and Sertoli cells are polarized, whereas the LH receptor-expressing cells are not polarized. Another question raised was whether the mechanisms of receptor basolateral delivery were cell-specific or whether the receptors contained specific signals that could direct them to this membrane compartment in any polarized cell. To answer these questions we have established MDCK cell lines that express the FSH, LH, and TSH receptors. Using these models we have analyzed the distribution of the receptors in polarized monolayers. MATERIALS AND METHODSCell Culture-MDCK cells (type II) were seeded and grown on coverslips (Nunc) or filters (0.4-m polycarbonate, tissue culture-treated, Transwell costar) as described previously (24,25).Antireceptor Antibodies-Mouse monoclonal antibodies FSHR323 (21), LHR38 (26),27) recognize an epitope in the extracellular domain of the FSH, LH, and TSH receptors, respectively. Antibody T3-365 has been raised against the intracellular domain of the TSH receptor (20). The rabbit polyclonal TSHR...