Pathogenicity Induced by Feline Leukemia Virus, Rickard Strain, Subgroup A Plasmid DNA (pFRA)

Chen, Hang; Bechtel, Marta K.; Shi, Yan; Phipps, Andrew J.; Mathes, Lawrence E.; Hayes, Kathleen; Roy-Burman, Pradip

doi:10.1128/jvi.72.9.7048-7056.1998

Cited by 35 publications

(16 citation statements)

References 53 publications

(85 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although the clinical significance of antigen-negative, PCR proviral DNA-positive status is still unknown, most such cats appear to remain aviremic and nonantigenemic, do not shed virus, and are unlikely to develop FeLV-associated diseases. Because FeLV provirus is infectious (Chen et al 1998), all feline blood donors should be tested for FeLV antigen by serology and for provirus by real-time PCR.…”

Section: Diagnosis Of Felvmentioning

confidence: 99%

2008 American Association of Feline Practitioners' feline retrovirus management guidelines

Levy

Crawford

Hartmann

et al. 2008

Journal of Feline Medicine and Surgery

178

216

View full text Add to dashboard Cite

Feline leukemia virus (FeLV) and feline immunodeficiency virus (FIV) are among the most common infectious diseases of cats. Although vaccines are available for both viruses, identification and segregation of infected cats form the cornerstone for preventing new infections. Guidelines in this report have been developed for diagnosis, prevention, treatment, and management of FeLV and FIV infections. All cats should be tested for FeLV and FIV infections at appropriate intervals based on individual risk assessments. This includes testing at the time of acquisition, following exposure to an infected cat or a cat of unknown infection status, prior to vaccination against FeLV or FIV, prior to entering group housing, and when cats become sick. No test is 100% accurate at all times under all conditions; results should be interpreted along with the patient's health and risk factors. Retroviral tests can diagnose only infection, not clinical disease, and cats infected with FeLV or FIV may live for many years. A decision for euthanasia should never be based solely on whether or not the cat is infected. Vaccination against FeLV is highly recommended in kittens. In adult cats, antiretroviral vaccines are considered non-core and should be administered only if a risk assessment indicates they are appropriate. Few large controlled studies have been performed using antiviral or immunomodulating drugs for the treatment of naturally infected cats. More research is needed to identify best practices to improve long-term outcomes following retroviral infections in cats.

show abstract

Section: Diagnosis Of Felvmentioning

confidence: 99%

2008 American Association of Feline Practitioners' feline retrovirus management guidelines

Levy

Crawford

Hartmann

et al. 2008

Journal of Feline Medicine and Surgery

178

216

View full text Add to dashboard Cite

show abstract

“…To investigate the stability of provirus carrying full-length transgenes in H927 genome, we performed PCR using genomic DNA extracted from different passages (P2, P15, P25) of H927-TK, -∆TK, -CD, and -GFP cells. A sense primer (RB43) based on a sequence conserved in the env gene of exogenous and endogenous FeLVs, and an antisense primer NuH20 complementary to exogenous FeLV-A U3 region in the LTR 16 were used so that both exogenous and potential recombinant proviral species could be detected. The approximate size of the amplified product carrying the full-length IRES-suicide gene insert was expected to be 2.26 kb, 2.13 kb, 1.61 kb, and 1.86 kb for H927-TK, -∆TK, -CD, and -GFP, respectively.…”

Section: Resultsmentioning

confidence: 99%

“…The primers used for this purpose consisted of an upstream primer RB43 representing a sequence at the 3´ end of FRA env gene which is conserved in both exogenous and endogenous FeLVs (FRA 7654´-7672, GAGAAA-GACTAAAACAGCG), and a downstream primer NuH20 complementary to exogenous-specific sequence in the U3 region of 3´ LTR. 16 The genomic DNA from passage 25 H927-TK, -∆TK, and -CD cells was also used to study the integrity of IRES-suicide gene cassette. The primers used include an upstream primer RB866 derived from 5´ end of IRES (IRES 1-20, TAACGTTACTGGCCGAAGCC), and downstream primers RB858 (TCAGTTAGCCTCCCCCATCTC) and RB859 (CTACTCAC-CAATATCTTCAAACCAATC) complementary to the 3´ end of HSV-TK and CD cDNA sequence, respectively.…”

Section: Methodsmentioning

confidence: 99%

“…13,14 There is evidence that FeLV-B and, probably FeLV-C also, are formed in vivo by recombination of FeLV-A SU sequences with corresponding, but varied endogenous FeLV-like elements. 3,11,[15][16][17][18][19][20][21][22][23][24][25][26] For entry FeLV-B and FeLV-C use the sodium-dependent phosphate symporter, [27][28][29] and a member of the major facilitator superfamily of transporters, 30,31 respectively. Since FeLV subgroups differ in receptor recognition for entry into target cells, a potential second infection could be by an FeLV different from the original subgroup, although this selectivity would be lost in time with the in vivo generation of recombinants representing a mixture of subgroups.…”

Section: Introductionmentioning

confidence: 99%

“…Since FeLV subgroups differ in receptor recognition for entry into target cells, a potential second infection could be by an FeLV different from the original subgroup, although this selectivity would be lost in time with the in vivo generation of recombinants representing a mixture of subgroups. 16,22,32 It is also possible that, the difficulty of superinfection may not be a barrier at an early stage of infection when infected cells may not be sufficiently enriched with viral products to block reinfection. Considering these opportunities, we initiated this present study in which GFP gene in a previously generated FeLV-GFP construct was replaced by a version of a suicide gene, including herpes simplex virus type1 thymidine kinase gene (HSV-TK), a truncated but still functional HSV-TK (HSV-∆TK), 33 and Saccharomyces cerevisiae cytosine deaminase (CD) gene (FCY1).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

A Potential Therapeutic Strategy to Combat Leukemia Virus Infection

Pan

Chen²,

Chang³

et al. 2003

Cancer Biology & Therapy

Self Cite

View full text Add to dashboard Cite

To test the concept that a replication-competent retrovirus carrying a suicide gene could have potential utility in the control of the natural virus infection in mammalian species, we constructed derivatives of a feline leukemia virus (FeLV) that is commonly associated with leukemia-lymphomas in this species. The FeLV, Rickard strain, subgroup A (FRA) genome contained at the 3' end of the envgene, an insert of an internal ribosomal entry site (IRES) linked to cDNA sequence of either herpes simplex virus thymidine kinase (HSV-TK) or a truncated HSV-TK (HSV-ATK) or yeast cytosine deaminase (CD). These constructs were transfected into feline fibroblast cells (H927). The viruses produced were determined to be replication-competent. The stable propagation of the full-length transgene was, however, dependent on the size of the insert, IRES-CD being the smallest in size (1031 bp) exhibiting maximal stability for at least up to six months. The protein products of the transgenes could be detected, despite the appearance of deleted proviruses at late passages. The transduced cells were susceptible to cytotoxic killing when the appropriate prodrug, ganciclovir (GCV), acyclovir (ACV) or 5-fluorocytosine (5-FC) was added to the culture medium. H927 cells, infected with another subgroup of FeLV, namely, FeLV-B or FeLV-C, could be superinfected by the FRA-suicide gene viruses and thus, subjected to killing. Interestingly, at an early stage of infection by the parental FRA, H927 cells could also be reinfected by the same subgroup FRA constructs to induce the suicide effect. Among the three constructs, the vector with the CD gene was determined to be superior to others in terms of stability, therapeutic index and bystander effect in the cell culture test system. While the in vivo correlates of the therapeutic effect in the feline model remain to be determined, our results do encourage investigation of the same concept in the control of HTLV and, perhaps even, HIV infection in humans.

show abstract

Inhibition of Feline Leukemia Virus Subgroup A Infection by Coinoculation with Subgroup B

et al. 2000

View full text Add to dashboard Cite

Feline leukemia virus (FeLV) subgroup B arises de novo through recombination between the env genes of exogenous FeLV subgroup A and endogenous FeLV-like sequences. FeLV-B, which by itself is poorly infectious, will increase to high titer in the presence of FeLV-A, and is associated with FeLV-related neoplastic disease. Although the participation of FeLV-B in disease progression has not been definitively proven, circumstantial evidence supports the hypothesis that the generation of FeLV-B is linked to disease progression. The present study was designed to evaluate whether increasing the levels of FeLV-B early in FeLV-A infection could result in reduction of the incubation period for development of neoplastic disease. For this study, an isolate of FeLV-B, designated FeLV-1B3, was biologically cloned, partially sequenced, and subgroup typed. In in vivo studies, none of the neonatal cats inoculated with FeLV-1B3 alone converted to viremia positive, and all remained healthy throughout the observation period. All of the kittens inoculated with FeLV-A alone became chronically viremic, and those held for long-term observation all developed either neoplastic disease or anemia. However, kittens inoculated with the combination of FeLV-1B3 and FeLV-A showed attenuated infections whereby the majority of cats failed to develop chronic viremia. The apparent interference of FeLV-A infection by FeLV-B was time and titer dependent. This unexpected result suggests that FeLV-B may act as an attenuated virus, causing inhibition of FeLV-A possibly through an immune-mediated mechanism. Partial support for this view was provided by postmortem examination of cats inoculated with FeLV-1B3 alone. Even though none of these cats became viremic, FeLV antigen was detected as focal infections in select tissues, especially salivary gland epithelium, where enough antigen may be expressed to provide an immunizing dose against gag and pol cross-reacting antigens. This work may also provide another approach to vaccine development based on endogenous retrovirus vector systems.

show abstract

Pathogenicity Induced by Feline Leukemia Virus, Rickard Strain, Subgroup A Plasmid DNA (pFRA)

Cited by 35 publications

References 53 publications

2008 American Association of Feline Practitioners' feline retrovirus management guidelines

2008 American Association of Feline Practitioners' feline retrovirus management guidelines

A Potential Therapeutic Strategy to Combat Leukemia Virus Infection

Inhibition of Feline Leukemia Virus Subgroup A Infection by Coinoculation with Subgroup B

Contact Info

Product

Resources

About