Partial 26S rDNA restriction analysis as a tool to characterise non-Saccharomyces yeasts present during red wine fermentations

Baleiras-Couto, Margarida; Reizinho, R.G.; Duarte, Filomena L.

doi:10.1016/j.ijfoodmicro.2005.01.005

Cited by 71 publications

(39 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The primers used for amplification of the D1/D2 domain of the 26S rDNA region were NL1 (5= GCATATCAATAAGCGGAGGAAAAG 3=) and NL4 (5= GGTCCGTGTTTCAAGACGG 3=) as described previously (21). PCRs were performed as described by Baleiras Couto et al (22) and Esteve-Zarzoso et al (23). The resulting sequences were compared with those available in the GenBank database at the National Center for Biotechnology Information (NCBI) using the basic local alignment search tool (BLAST).…”

Section: Methodsmentioning

confidence: 99%

In SituAnalysis of Metabolic Characteristics Reveals the Key Yeast in the Spontaneous and Solid-State Fermentation Process of Chinese Light-Style Liquor

Zhang

et al. 2014

Appl Environ Microbiol

View full text Add to dashboard Cite

The in situ metabolic characteristics of the yeasts involved in spontaneous fermentation process of Chinese light-style liquor are poorly understood. The covariation between metabolic profiles and yeast communities in Chinese light-style liquor was modeled using the partial least square (PLS) regression method. The diversity of yeast species was evaluated by sequence analysis of the 26S ribosomal DNA (rDNA) D1/D2 domains of cultivable yeasts, and the volatile compounds in fermented grains were analyzed by gas chromatography (GC)-mass spectrometry (MS). Eight yeast species and 58 volatile compounds were identified, respectively. The modulation of 16 of these volatile compounds was associated with variations in the yeast population (goodness of prediction [Q 2 ] > 20%). The results showed that Pichia anomala was responsible for the characteristic aroma of Chinese liquor, through the regulation of several important volatile compounds, such as ethyl lactate, octanoic acid, and ethyl tetradecanoate. Correspondingly, almost all of the compounds associated with P. anomala were detected in a pure culture of this yeast. In contrast to the PLS regression results, however, ethyl lactate and ethyl isobutyrate were not detected in the same pure culture, which indicated that some metabolites could be generated by P. anomala only when it existed in a community with other yeast species. Spontaneous and solid-state fermentation has been used for thousands of years for the preparation of traditional foods such as bread, tempeh, yogurt, and cheese (1-3). Spontaneously fermented foods are generally characterized by a wide variety of tastes and textures, and sensory properties of the foods are generally determined by the involved microflora, besides the raw material (4, 5). With this in mind, it is therefore important to identify the functional microorganisms contributing to the formation of food flavors.The metabolic characteristics of lactic acid bacteria (LAB) and yeasts have been studied extensively (6-8), and their effects on food flavor have been highlighted through the detection of the corresponding metabolites in pure cultures. Although these studies have provided valuable information regarding the individual species, they take no account of the fact that the level of volatiles produced by a single species may be influenced by other species in a mixed-culture system. The different flavors of foods would be determined to a large extent by the in situ metabolic characteristics of different microorganisms. Several studies have already described the metabolic characteristics of mixed cultures with the aim of identifying the effects of individual strains on the generation of volatile compounds (9-12). For instance, the metabolic footprints of each strain of Saccharomyces in monoculture and mixed cultures were derived during wine fermentation (9). This showed that the volatile compounds produced in the mixed culture could not be predicted based on the volatiles observed in the monocultures of the same yeast species. Recent work i...

show abstract

Section: Methodsmentioning

confidence: 99%

In SituAnalysis of Metabolic Characteristics Reveals the Key Yeast in the Spontaneous and Solid-State Fermentation Process of Chinese Light-Style Liquor

Zhang

et al. 2014

Appl Environ Microbiol

View full text Add to dashboard Cite

show abstract

“…Due to the enological relevance, all Saccharomyces cerevisiae isolates were differentiated applying two genotypic tools (interdelta analysis and microsatellite multiplex PCR of polymorphic microsatellite loci) that recognized 51 strains. Based on the low production of H 2 S, acetic acid and foam, ethanol resistance, growth in presence of high concentrations of potassium metabisulphite (KMBS) and CuSO 4 and at low temperatures, 14 strains were selected and used as starter to ferment grape must at 13 C and 17 C in presence of 100 mg/L of KMBS. Three strains (CS160, CS165 and CS182) showed optimal technological aptitudes.…”

mentioning

confidence: 99%

“…Standard DNA ladders were 1 kb Plus DNA Ladder (Invitrogen) and GeneRuler 50 pb DNA Ladder (MBI Fermentas). Five isolates representative of each group were subjected to an additional enzymatic restriction targeting the 26 rRNA gene following the methodology reported by Baleiras-Couto et al (13). One isolate per group was further processed by sequencing the D1/D2 region of the 26S rRNA gene and/or 5.8S-ITS rRNA region to confirm the preliminary identification obtained by RFLP analysis (14).…”

mentioning

confidence: 99%

Yeast ecology of vineyards within Marsala wine area (western Sicily) in two consecutive vintages and selection of autochthonous Saccharomyces cerevisiae strains

Settanni

Sannino

Francesca

et al. 2012

Journal of Bioscience and Bioengineering

View full text Add to dashboard Cite

In this work, the yeast ecology associated with the spontaneous fermentation of Grillo cultivar grapes from 10 vineyards was analyzed from grape harvest till complete consumption of must sugars. The microbiological investigation started with the plate count onto two culture media to distinguish total yeasts (TY) and presumptive Saccharomyces (PS). Yeasts were randomly isolated and identified by a combined genotypic approach consisting of restriction fragment length polymorphism (RFLP) of 5.8S rRNA gene and 26S rRNA and sequencing of D1/D2 domain of the 26S rRNA gene, which resulted in the recognition of 14 species belonging to 10 genera. The distribution of the yeasts within the vineyards showed some differences in species composition and concentration levels among 2008 and 2009 vintages. Due to the enological relevance, all Saccharomyces cerevisiae isolates were differentiated applying two genotypic tools (interdelta analysis and microsatellite multiplex PCR of polymorphic microsatellite loci) that recognized 51 strains. Based on the low production of H 2 S, acetic acid and foam, ethanol resistance, growth in presence of high concentrations of potassium metabisulphite (KMBS) and CuSO 4 and at low temperatures, 14 strains were selected and used as starter to ferment grape must at 13 C and 17 C in presence of 100 mg/L of KMBS. Three strains (CS160, CS165 and CS182) showed optimal technological aptitudes.

show abstract

“…Connell et al [22] adapted this same technique for the detection of D. bruxellensis in winery air. [5,22,40,55,113] Yeast targets Direct Species to strain [18,49,61] QPCR Bacterial targets Direct Currently species but depending on the target gene they may be strain specific [45,78,106] Yeast targets Direct Currently species [27,45,47,89,93,108] Both papers consider this method to be a form of in situ hybridization, however, in this case it is not a direct detection method, as the probes are used on an enriched culture grown on media. Even though the technique takes less time than traditional indirect methods, growth of the organism is still needed.…”

Section: Hybridization Methodsmentioning

confidence: 99%

“…While ARDRA typing has typically been performed to identify yeast species using the ITS regions discussed above, Balerias Couto et al [5] used restriction enzyme analysis of the 26S rDNA to characterize non-Saccharomyces yeasts in wine. Additionally, restriction analysis of the 16S rDNA region in bacteria has also been used to identify both Lactobacilli and acetic acid bacteria associated with wine [96,98].…”

Section: Fingerprinting Methodsmentioning

confidence: 99%

Detection and identification of microorganisms in wine: a review of molecular techniques

Ivey

Phister

2011

J Ind Microbiol Biotechnol

View full text Add to dashboard Cite

The microbial ecology of wine is complex. Microbes can play both positive and negative roles in the quality of the final product. Due to this impact, the microbial ecology of wine has been well studied. Traditional indirect methods, such as plating, have largely been replaced by a number of molecular methods. These methods are typically either indirect methods used for identification of cultured organisms, or direct methods used to profile whole populations or identify specific microbes in a mixed population. These molecular methods offer a number of advantages over traditional methods including speed and precision. This review will examine both direct and indirect molecular methods, provide examples of their impact on the study of the microbial ecology of wine, and also discuss their strengths and limitations.

show abstract

Partial 26S rDNA restriction analysis as a tool to characterise non-Saccharomyces yeasts present during red wine fermentations

Cited by 71 publications

References 18 publications

In SituAnalysis of Metabolic Characteristics Reveals the Key Yeast in the Spontaneous and Solid-State Fermentation Process of Chinese Light-Style Liquor

In SituAnalysis of Metabolic Characteristics Reveals the Key Yeast in the Spontaneous and Solid-State Fermentation Process of Chinese Light-Style Liquor

Yeast ecology of vineyards within Marsala wine area (western Sicily) in two consecutive vintages and selection of autochthonous Saccharomyces cerevisiae strains

Detection and identification of microorganisms in wine: a review of molecular techniques

Contact Info

Product

Resources

About