Paraoxonase polymorphisms PON1 192 and 55 and longevity in Italian centenarians and Irish nonagenarians. A pooled analysis

Rea, Irene Maeve; McKeown, Pascal; McMaster, Dorothy; Young, Ian S.; Patterson, Chris; Savage, Maurice; Belton, Christine; Marchegiani, Francesca; Olivieri, Fabiola; Bonafè, Massimiliano; Franceschi, Claudio

doi:10.1016/j.exger.2003.11.019

Cited by 64 publications

(49 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…With aging, the quantity and the quality of HDL are significantly altered (Park and Cho 2011). We have shown that HDL is oxidatively altered with aging and exhibits reduced anti-oxidant and anti-inflammatory activity, as this is also a characteristic in chronic inflammatory diseases (Jaouad et al 2006;, and consistent with the predictions of the Inflamm-Aging model (Khalil et al 2012;Rea et al 2004). Whether these age-related changes in HDL biology contribute to T cell immunosenescence is currently unknown.…”

Section: Introductionsupporting

confidence: 63%

Immunomodulatory role of high-density lipoproteins: impact on immunosenescence

Larbi

Fortin

Dupuis

et al. 2014

AGE

View full text Add to dashboard Cite

Natural aging is accompanied by a dysregulation of the host immune response that has well-known clinical consequences but poorly defined underlying causes. It has previously been reported that advancing age is associated with an increase in membrane cholesterol level in T cells. The aim of this study was to investigate whether high-density lipoprotein (HDL) can modulate the age-related accumulation of membrane cholesterol in T cells and impact on their subsequent responsiveness. Our data reveal that cholesterol metabolism, influx, and efflux are altered in T cells with aging, which may in part explain the increase in membrane cholesterol level observed in T cells in elderly individuals. HDL was unable to promote reverse cholesterol transport in T cells from elderly subjects with the same efficiency as was observed in T cells from young subjects besides unchanged ABCA-1 and SR-BI expressions. HDL exhibited a short-acting co-stimulatory effect by enhancing T cell production of interleukin-2 (IL-2). Moreover, HDL from healthy normolipemic individuals exerted differential effects on T cell proliferation that depended on the age of the HDL donor. Finally, HDL modulated TCR/CD28 activation by inducing sustained signaling through pLck, pERK, and pAkt. These data suggest that HDL has immunomodulatory effects on T cells that are influenced by age.

show abstract

Section: Introductionsupporting

confidence: 63%

Immunomodulatory role of high-density lipoproteins: impact on immunosenescence

Larbi

Fortin

Dupuis

et al. 2014

AGE

View full text Add to dashboard Cite

show abstract

Section: Human Genes and Longevitymentioning

confidence: 99%

“…Genetic analysis of human ageing is mainly approached by searching the genetic basis of susceptibility to major geriatric disorders or the allelic contributions to exceptionally long life span. It is just thanks to these last studies in centenarians populations that several candidate longevity genes or pathways including PON1 [19,130], IGF1/insulin pathway [84,120], elements of lipid metabolism [12], stress response [34] and inflammatory response have been identified [53].Genes related to inflammation and stress response, in particular the pro-inflammatory cytokines IL-1, IL-6, TNFalpha, the anti-inflammatory cytokine IL-10, the HSP70 chaperones and the regulators of trace elements homeostasis, metallothioneins (MT), seem particularly relevant taking into account that the same genes are involved in the susceptibility to major geriatric disease/disorders such as …”

mentioning

confidence: 99%

Zinc–gene interaction related to inflammatory/immune response in ageing

Mocchegiani

Malavolta

2008

Genes Nutr

View full text Add to dashboard Cite

The pivotal role played by zinc-gene interaction in affecting some relevant cytokines (IL-6 and TNF-a) and heat shock proteins (HSP70-2) in ageing, successful ageing (nonagenarians) and the most common age-related diseases, such as atherosclerosis and infections, is now recognized. The polymorphisms of genes codifying proteins related to the inflammation are predictive on one hand in longevity, on the other hand they are associated with atherosclerosis or severe infections. Since the health lifespan has a strong genetic component, which in turn also affected by nutritional factors like zinc, the association of these polymorphisms with innate immune response, zinc ion bioavailability and Metallothioneins (MT) homeostasis is an useful tool to unravel the role played by zinc-gene interactions in longevity, especially due to the inability of MT in zinc release in ageing and chronic inflammation. In ageing, this last fact leads to depressed innate immune response for host defence. In contrast, in very old age the inflammation is lower with subsequent more zinc ion bioavailability, less MT gene expression and satisfactory innate immunity. Therefore, the zinc-gene (IL-6, TNF-a, Hsp70-2) interactions, via MT homeostasis, are crucial to achieve successful ageing. Human genes and longevityAgeing is a universal phenomenon that affects nearly all of animal species. According to Helfand and Rogina [69], ageing can be characterized as: (1) an inevitable consequence of being a multicellular organism; (2) associated with a random, passive decline in function; (3) leading to a global loss of homeostasis over time and (4) mortality increasing with ageing. Evolutionary studies on ageing have drawn the attention on the importance of the genetic mechanisms involved in somatic maintenance and repair that secure longevity [82]. Evidence from model organisms has indicated that subtle variation in the genes can dramatically influence lifespan. However, findings on potential candidate genetic mechanisms determining ageing and lifespan in model organisms are far to explain variations in human populations because phenotypes are critically dependent on the setting in which genes are expressed, while laboratory conditions and modern environments are markedly dissimilar [86]. Genetic analysis of human ageing is mainly approached by searching the genetic basis of susceptibility to major geriatric disorders or the allelic contributions to exceptionally long life span. It is just thanks to these last studies in centenarians populations that several candidate longevity genes or pathways including PON1 [19,130], IGF1/insulin pathway [84,120], elements of lipid metabolism [12], stress response [34] and inflammatory response have been identified [53].Genes related to inflammation and stress response, in particular the pro-inflammatory cytokines IL-1, IL-6, TNFalpha, the anti-inflammatory cytokine IL-10, the HSP70 chaperones and the regulators of trace elements homeostasis, metallothioneins (MT), seem particularly relevant taking into accoun...

show abstract

“…PCR amplification was amplified using forward 5'GAAGAGTGATGTATAGCCCCAG3' and reverse 5'TTTAATCCAGAGCTAATGAAA-GCC3' primers. 25 The 0 C for 10 min. 25 PCRamplified DNA fragments were digested with 10U Hsp92II (Promega, Southampton, UK) at 37 0 C for 16 h and analyzed following the electrophoresis in 3% agarose gel stained with ethidiumbromide (0.5 μg/mL).…”

Section: Genotype Analysismentioning

confidence: 99%

“…25 The 0 C for 10 min. 25 PCRamplified DNA fragments were digested with 10U Hsp92II (Promega, Southampton, UK) at 37 0 C for 16 h and analyzed following the electrophoresis in 3% agarose gel stained with ethidiumbromide (0.5 μg/mL). The L allele (wild-type) produced an undigested product of 170 bp, whereas M allele produced two products: 126 bp and 44 bp.…”

Section: Genotype Analysismentioning

confidence: 99%

Association Between PON1 L55M Polymorphism and PON1 Enzyme Activity in Patients with Leukemia.

Eras¹,

Tombak²,

Yalın³

et al. 2017

UHOD

View full text Add to dashboard Cite

Paraoxonase 1 (PON1) is an important antioxidant enzyme which has a role in preventing the effects of systemic oxidative stress. The purpose of our study was to investigate the possible association between PON1 L55M polymorphism and leukemia development and to determine the relationship between PON1 genotypes and PON1 enzyme activities. Genotypes of 102 cases and 112 healthy controls were determined by PCR-RFLP. PON1 enzyme activity was determined according to Eckerson's method. The ratio of MM genotype belonging to PON1 L55M polymorphism in control group was 6.3% and was 7.8% in patients with leukemia (p= 0.39). PON1 enzyme activity was 118.8 ± 115.1 U/mL in control group, while decreased to 75.6 ± 64.4 U/mL in patients with leukemia (p= 0.004). PON1 enzyme activities of the individuals with MM genotypes belonging to PON1 L55M polymorphism was 57.43 ± 21.61 U/ mL in control group and decreased to 39.18 ± 45.61 U/mL in leukemic patients. Our results suggest that, PON1 L55M polymorphism genotype ratios do not affect leukemia development. However, reduced PON1 enzyme activity and also the combination of PON1 L55M polymorphism with reduced PON1 enzyme activity are associated with the increased risk of leukemia. Furthermore, older age may be a risk factor for developing leukemia. PON1 enzim aktivitesi Eckerson yöntemi ile ölçüldü. PON1 L55M polimorfizmine ait MM genotip oranları kontrol grubunda %6.3 iken lösemili hastalarda % 7.8 idi (p= 0.39). PON1 enzim aktivitesi kontrol grubunda 118.8 ± 115.1 U/mL iken lösemili hastalarda düşük olarak saptandı (75.6 ± 64.4 U/mL, p= 0.004). PON1 L55M polimorfizmine ait MM genotipli bireylerin PON1 enzim aktivitesi kontrol grubunda 57.43 ± 21.61 U/mL iken lösemili hastalarda düşük olarak saptandı (39.18 ± 45.61 U/mL). Bizim bulgularımız PON1 L55M polimorfizmi genotip oranlarının lösemi gelişimini etkilemediğini göstermektedir. Bununla birlikte, düşük PON1 enzim aktivitesi tek başına ve PON1 L55M polimorfizmi ile birlikte lösemi riski artışı ile ilişkilidir. Ayrıca ileri yaş lösemiye yakalanma olasılığını yükseltir.

show abstract

Paraoxonase polymorphisms PON1 192 and 55 and longevity in Italian centenarians and Irish nonagenarians. A pooled analysis

Cited by 64 publications

References 52 publications

Immunomodulatory role of high-density lipoproteins: impact on immunosenescence

Immunomodulatory role of high-density lipoproteins: impact on immunosenescence

Zinc–gene interaction related to inflammatory/immune response in ageing

Association Between PON1 L55M Polymorphism and PON1 Enzyme Activity in Patients with Leukemia.

Contact Info

Product

Resources

About