Paraoxonase-1 Regulation of Renal Inflammation and Fibrosis in Chronic Kidney Disease

Abstract

Papraoxonase-1 (PON1) is a hydrolytic lactonase enzyme that is synthesized in the liver and circulates attached to high-density lipoproteins (HDL). Clinical studies have demonstrated an association between diminished PON-1 and the progression of chronic kidney disease (CKD). However, whether decreased PON-1 is mechanistically linked to renal injury is unknown. We tested the hypothesis that the absence of PON-1 is mechanistically linked to the progression of renal inflammation and injury in CKD. Experiments were performed on control Dahl salt-sensitive rats (SSMcwi, hereafter designated SS rats) and Pon1 knock-out rats (designated SS-Pon1em1Mcwi, hereafter designated SS-PON-1 KO rats) generated by injecting a CRISPR targeting the sequence into SSMcwi rat embryos. The resulting mutation is a 7bp frameshift insertion in exon 4 of the PON-1 gene. First, to examine the renal protective role of PON-1 in settings of CKD, ten-week-old, age-matched male rats were maintained on a high-salt diet (8% NaCl) for up to 5 weeks to initiate the salt-sensitive hypertensive renal disease characteristic of this model. We found that SS-PON-1 KO rats demonstrated several hallmarks of increased renal injury vs. SS rats including increased renal fibrosis, sclerosis, and tubular injury. SS-PON-1 KO also demonstrated increased recruitment of immune cells in the renal interstitium, as well as increased expression of inflammatory genes compared to SS rats (all p < 0.05). SS-PON-1 KO rats also showed a significant (p < 0.05) decline in renal function and increased renal oxidative stress compared to SS rats, despite no differences in blood pressure between the two groups. These findings suggest a new role for PON-1 in regulating renal inflammation and fibrosis in the setting of chronic renal disease independent of blood pressure.

Cardioprotective Role for Paraoxonase-1 in Chronic Kidney Disease

“…Other investigators have shown a similar development of compensated concentric hypertrophy in congenic substrains of the Dahl salt-sensitive and Dahl salt-resistant rat strains, and these changes were associated with increased blood pressure [ 37 ]. We measured blood pressure via both tail-cuff plethysmography and radiotelemetry in a companion study, and demonstrated that that there is no difference in blood pressure between SS-PON-1 KO and SS-WT rats after 4 weeks on an 8% high-salt diet [ 21 ]. This suggests that the changes seen in the SS-PON-1 KO hearts are not the result of an increased afterload from elevated blood pressure, but rather from a more direct pathophysiologic effect of the loss of PON-1 on the cardiac structure and function.…”

“…These studies also revealed associations between lower-circulating PON activities and a higher cardiovascular mortality risk. Importantly, a recent study from our lab reported early mortality in SS-PON-1 KO rats on a high-salt diet (8%NaCl) without any mortality reported in SS-WT rats [ 21 ]. The study showed that SS-PON-1 KO rats had significant decreases in renal function along with increased renal inflammation and oxidative stress compared to SS-WT rats.…”

“…Notably, SS-PON-1 KO and SS-WT rats demonstrated similar increases in blood pressure after high-salt feeding. Hence, similar to the cardiac phenotype, the detected differences in the renal phenotype between SS-PON-1 KO and SS-WT rats could not be linked to differences in blood pressure [ 21 ]. These results support experimental and clinical data that imply a protective role of PON-1 in CKD settings [ 7 , 8 , 51 ].…”

“…All animal studies were performed in accordance with the National Institutes of Health’s Guide for the Care and Use for Laboratory Animals and approved by the Institutional Animal Care and Use Committee at the University of Toledo. Control Dahl salt-sensitive rats (SS Mcwi , henceforth called SS-WT rats) as well as PON-1 mutant rats (SS-PON-1em1Mcwi, henceforth called SS-PON-1 KO rats) were generated by the Medical College of Wisconsin Gene Editing Rat Resource Center as we have previously described [ 21 ]. Briefly, SS-PON-1 KO rats were created via CRISPR insertion by directing the sequence AGTATTTTTCCAGGCTTACTGG into embryos of SS rats.…”

“…Gene expression was calculated by comparing the relative change in the cycle threshold value (ΔCt). The 2 −ΔΔCt equation was then used to calculate the fold change in the gene expression as previously described [ 21 ].…”