Paper‐Based Bacterial Lysis Enables Sample‐to‐Answer Home‐based DNA Testing

Abstract

Nucleic acid amplification testing (NAAT) is the gold standard for infectious disease diagnostics. Currently NAATs are mainly limited to centralized laboratories, while paper‐based antigen tests are used for rapid home‐based diagnostics. DNA extraction, the initial sample preparation step in NAATs, remains a bottleneck that hinders its development toward home‐based kits. This step requires the use of compounds detrimental to the enzymes in downstream DNA amplification. Here, this work overcomes this bottleneck by immobilizing the enzyme achromopeptidase (ACP) on nitrocellulose, to both store and enable the separation of the enzymes from the other steps. This work provides proof‐of‐concept that immobilized ACP is effective at lysis and release of amplifiable DNA from gram‐positive Staphylococcus epidermidis and enables the use of the lysate directly for DNA amplification, without the need for heat deactivation of the enzyme. This sample preparation method requires only incubation at 37 °C and mild agitation, which allows to implement it with fully disposable and affordable equipment. Consequently, this work enables to combine the paper‐based DNA extraction method with the isothermal recombinase polymerase amplification (RPA) followed by lateral flow detection to demonstrate a sample‐to‐answer NAAT packaged as an instrument free self‐test kit expanding the capabilities of home‐testing beyond antigen tests.

A 3D paper microfluidic device for enzyme‐linked assays: Application to DNA analysis

“…After a wash-free sandwich coupling to generate the bead/analyte/enzyme complexes, these were loaded onto the device and subsequently retained on the nitrocellulose membrane. lysis [33,34] and isothermal amplification in porous substrates, [24] as well as miniaturization. [48] The robustness and simplicity of manufacturing these devices at scale makes them a good option for quantitative and more sensitive paper-based tests compared to classic LFAs.…”

“…Future work should be directed toward reducing the time needed for the sandwich coupling and assessing the storage stability of the dried chromogenic substrate on paper. When targeting DNA, ongoing research should aim to fully integrate the sample preparation and amplification steps into the μEL‐PAD, as we have demonstrated successful cell lysis [ 33,34 ] and isothermal amplification in porous substrates, [ 24 ] as well as miniaturization. [ 48 ] The robustness and simplicity of manufacturing these devices at scale makes them a good option for quantitative and more sensitive paper‐based tests compared to classic LFAs.…”

“…Primers for the SE‐0105 gene of S. epidermidis used in this work were based on those previously described [ 34 ] and modified with Biotin and FITC. The sequences of primers were Biotin‐ AGGCTTAATTATCTCTGTTTTAGGAGCTT and FITC‐ TAGGCACTATCTGTAAACAACATACTAAT for the forward and reverse primer, respectively.…”

“…RPA reactions were performed at 37 °C for 30 min in a low‐cost and portable thermal block following previously optimized parameters. [ 34 ] Briefly, each RPA reaction (50 μL) contained: 3.2 μL of nuclease‐free water, 29.5 μL of rehydration buffer, 1 lyophilized enzyme pellet, 2.4 μL of 10 μM of labeled primers, 2.5 μL of 480 mM magnesium acetate and 10 μL of extracted genomic DNA (positive samples) from bacterial cells, which corresponded to: (a) 10 4 genome copies/μL for the optimization of the enzyme‐linked assay in solution; and (b) 10 4 –10 1 genome copies/μL for the construction of the calibration curves. Blanks with nuclease‐free water (NTC = no template control) were included in all experiments.…”

“…RPA reactions were performed at 37 • C for 30 min in a low-cost and portable thermal block following previously optimized parameters. [34] Briefly, each RPA reaction (50 μL) contained:…”