Pancreatic Sirtuin 3 Deficiency Promotes Hepatic Steatosis by Enhancing 5-Hydroxytryptamine Synthesis in Mice With Diet-Induced Obesity

Abstract

Sirtuin 3 (SIRT3) is a protein deacetylase regulating beta cell function through inhibiting oxidative stress in obese and diabetic mice, but the detailed mechanism and potential effect of beta cell specific SIRT3 on metabolic homeostasis, and its potential effect on other metabolic organs are unknown. We found glucose tolerance and glucose stimulated insulin secretion (GSIS) were impaired in high fat diet (HFD)-fed beta cell selective Sirt3 knockout (Sirt3 f/f;Cre/+) mice. In addition, Sirt3 f/f;Cre/+ mice had more severe hepatic steatosis than Sirt3 f/f mice upon HFD feeding. RNA sequencing (RNA-Seq) of islets suggested that Sirt3 deficiency over-activated 5hydroxytryptamine (5-HT) synthesis as evidenced by up-regulation of tryptophan hydroxylase 1 (TPH1). 5-HT concentration was increased in both islets and serum of Sirt3 f/f;Cre/+ mice. 5-HT also facilitated the effect of palmitate to increase lipid deposition. Treatment with TPH1 inhibitor ameliorated hepatic steatosis and reduced weight gain in HFD-fed Sirt3 f/f;Cre/+ mice. These data suggested that under HFD feeding, SIRT3 deficiency in beta cells not only regulates insulin secretion but also modulates hepatic lipid metabolism via the release of 5-HT.

The second-generation antipsychotic drug aripiprazole modulates the serotonergic system in pancreatic islets and induces beta cell dysfunction in female mice

“…These results were supported by: (1) the ex vivo treatment of islets with aripiprazole, which similarly resulted in increased TPH1 expression; (2) the decrease in insulin secretion in islets treated with serotonin that, like aripiprazole, activated mTORC1/S6 signalling; (3) and the recovery of GSIS in islets treated ex vivo with aripiprazole together with a TPH1 inhibitor, pointing to serotonin-mediated inhibition of insulin secretion by this SGA. Our findings are in agreement with a recent study showing that Sirtuin 3 deficiency in beta cells increased Tph1 expression, along with impairment of GSIS in obese mice [ 38 ].…”

Autotaxin signaling facilitates β cell dedifferentiation and dysfunction induced by Sirtuin 3 deficiency

“…FBS, 100 U/ml penicillin, 0.1 mg/mL streptomycin and 110 μmol/L 2-mercaptoethanol (Invitrogen, USA). Pancreatic islets were isolated from the male Sirt3 f/f;Cre/+ and Sirt3 f/f mice as previously described [ 13 , 14 ]. We applied 0.8 mg/mL Collagenase P (Roche, Switzerland) solution (around 3 mL), which was dissolved in Hanks’ balanced salt solution HBSS (Invitrogen) for pancreas digestion.…”

“…We used published methods to knock down Sirt3 expression in MIN6 cells [ 14 ]. For specific knockdown Enpp2 expression in mouse pancreatic β cells, the Mus Enpp2 shRNA plasmids were purchased from Sun Yuen Technology Limited (Hong Kong) and the shRNA construct sequences are as follows: shRNA- Enpp2 -1: 5′-CCGGCGACCCAAGATTCCCAATAATCTCGAGATTATTGGGAATCTTGGGTCGTTTTTG -3’; shRNA- Enpp2 -2: 5′-CCGGCCTGTACCAAATCTGACATATCTCGAGATATGTCAGATTTGGTACAGGTTTTTG -3’; shRNA Enpp2 -3: 5′-CCGGGCCTTCAGTTTATGCCTTCTACTCGAGTAGAAGGCATAAACTGAAGGCTTTTTG -3′ and expressed scrambled negative shRNA: 5′-TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTT -3’.…”

“…To further elucidate the role of SIRT3 in the regulation of pancreatic β cells, our group has established the β cell-selective Sirtuin3 ( Sirt3 ) knockout ( Sirt3 f/f;Cre/+ ) mice by Ins2 Cre driven deletion of the Sirt3 allele. After HFD feeding these Sirt3 f/f;Cre/+ mice exhibited a mixed phenotype including impaired glucose tolerance, reduced GSIS and increased hepatic steatosis [ 14 ]. Inhibiting 5-hydroxytryptamine synthesis in β cells from Sirt3 f/f;Cre/+ mice improved HFD-induced hepatic steatosis but failed to improve glucose tolerance [ 14 ].…”

“…After HFD feeding these Sirt3 f/f;Cre/+ mice exhibited a mixed phenotype including impaired glucose tolerance, reduced GSIS and increased hepatic steatosis [ 14 ]. Inhibiting 5-hydroxytryptamine synthesis in β cells from Sirt3 f/f;Cre/+ mice improved HFD-induced hepatic steatosis but failed to improve glucose tolerance [ 14 ]. These findings implicated alterative mechanisms in β cell dysfunction induced by Sirt3 deficiency.…”