Palladium(II)‐coproporphyrin I as a photoactivable group in sequence‐specific modification of nucleic acids by oligonucleotide derivatives

Fedorova, Olga S.; Савицкий, А. П.; Shoikhet, K.G.; Ponomarev, G. V.

doi:10.1016/0014-5793(90)80041-g

Cited by 29 publications

(19 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Similar results in sensitized photomodification of nucleic acids were obtained earlier with conjugates containing other reactive groups, including porphyrins and their analogs, such as Pd(II)-coproporphyrin I [20], chlorine [21], sapphyrin, and Dy(III) texaphyrin [22]. Using oligonucleotide tags, it is possible to target the reagent to the required nucleic acid sequence, thus enhancing the selectivity of the process.…”

Section: Discussionsupporting

confidence: 61%

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Chernonosov

Koval²,

Knorre³

et al. 2006

Bioinorganic Chemistry and Applications

View full text Add to dashboard Cite

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen , while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.

show abstract

Section: Discussionsupporting

confidence: 61%

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Chernonosov

Koval²,

Knorre³

et al. 2006

Bioinorganic Chemistry and Applications

View full text Add to dashboard Cite

show abstract

“…An early work (Fedorova et al, 1990) on a Pd(II)-coproporphyrin I conjugated to a 17-mer DNA reported on the selective photocleavage of a complementary DNA sequence after irradiation at 330-410 nm. Photogenerated crosslink products were detected, which were further treated with hot piperidine to reveal specific oxidation of guanine in close proximity to the dye.…”

Section: Metal Complexes Based On Porphyrin-like Ligands As Chromophoresmentioning

confidence: 99%

Site-Specific DNA Photocleavage and Photomodulation by Oligonucleotide Conjugates

Kolevzon

Yavin

2010

Oligonucleotides

View full text Add to dashboard Cite

Triplex-forming oligonucleotides have been explored in the last 3 decades as highly specific gene-modifying agents. Such agents have been showed to either upregulate or shut down gene expression in vitro, an outcome that depends on the specifically designed biological system. One interesting approach is to tether to the oligonucleotide a photoreactive moiety. After hybridization to the DNA target (typically single- or double-stranded DNA), a site-specific photoinduced reaction may take place at a timely manner. Further, as the light source may be focused at a certain area, one has control on the location at which the phototriggered DNA modification takes place. In this regard, the use of tissue-penetrating photons (typically 630-950 nm) would be most relevant for in vivo applications as photoactivation may lead to site-specific DNA modification at a specific tissue/organ. In this review we highlight the advances made in this field and discuss the hurdles that lay ahead for the realization of phototriggered triplex-forming oligonucleotides as a solid therapeutic approach.

show abstract

“…Many of the applications where porphyrins are used as molecular probes in aqueous media (fluorescent probes [1,2], phosphorescent probes [3][4][5][6], photosensitizing probes [7][8][9][10], chemiluminescent catalysts [11]) require the possibility for a site-specific attachment of the probe to a target molecule. A prerequisite for such site-specific attachment (later: labeling) is that the probe molecule includes a single chemical functional group of a kind (later: monosubstituted) which can be selectively reacted with a chemical group present in the target molecule.…”

Section: Introductionmentioning

confidence: 99%

Preparation of monofunctional and phosphorescent palladium(II) and platinum(II) coproporphyrin labeling reagents

Soini

Yashunsky

Meltola

et al. 2001

J. Porphyrins Phthalocyanines

View full text Add to dashboard Cite

A method is described for preparation of monosubstituted derivatives of platinum and palladium coproporphyrin-I. The method is based on chemical differentiation of one of the four alkoxycarbonyl groups of the starting coproporphyrin-I tetraalkyl ester by selective acid hydrolysis. The hydrolysis results after chromatographic purification to pure mono hydroxycarbonyl coproporphyrin, which can be subsequently coupled with a chemical species carrying a functional group of interest. The described method is used for preparation of phosphorescent metalloporphyrin labeling reagents having an isothiocyanato reactive group.

show abstract

Palladium(II)‐coproporphyrin I as a photoactivable group in sequence‐specific modification of nucleic acids by oligonucleotide derivatives

Abstract: The 34-mer oligodeoxynucleotide was shown to be selectively modified at the G17 position upon photoirradiation in the presence of complementary 17-mer oligodeoxynucleotide bearing Pd(II)-coproporphyrin I covalently linked to the S-end phosphate group.

Cited by 29 publications

References 17 publications

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Site-Specific DNA Photocleavage and Photomodulation by Oligonucleotide Conjugates

Preparation of monofunctional and phosphorescent palladium(II) and platinum(II) coproporphyrin labeling reagents

Contact Info

Product

Resources

About