Paired related homeobox protein‐like 1 (Prrxl1) controls its own expression by a transcriptional autorepression mechanism

Monteiro, Clara; Costa, Mariana Fontes da; Reguenga, Carlos; Lima, Deolinda; Castro, Diogo S.; Monteiro, Filipe Almeida

doi:10.1016/j.febslet.2014.08.006

Cited by 10 publications

(12 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recent evidence indicates that paired-related homeobox protein family play a critical role in tumor progression and drug resistance by promoting cell growth, immune escape and angiogenesis [18]. Previous study reported that Prrx1 over-expresse was associated with more aggressive capability and poor prognosis of patients with thyroid cancer and colorectal cancer [19, 20].…”

Section: Discussionmentioning

confidence: 99%

Silencing of Prrx2 Inhibits the Invasion and Metastasis of Breast Cancer both In Vitro and In Vivo by Reversing Epithelial-Mesenchymal Transition

Lv¹,

Wang

Liu

et al. 2017

Cell Physiol Biochem

View full text Add to dashboard Cite

Background/Aims: Epithelial-mesenchymal transition (EMT) is recognized as a crucial mechanism in breast cancer progression and metastasis. Paired-related homeobox 2 (Prrx2) has been identified as a new EMT inducer in cancer, but the underlying mechanisms are still poorly understood. Methods: The expression of Prrx2 was assessed by immunohistochemistry in breast cancer tissues to evaluate the clinicopathological significance of Prrx2, as well as the correlation between Prrx2 and EMT. Short hairpin RNA knockdown of Prrx2 was used to examine cellular effects of Prrx2, detecte the expression of Wnt/β-catenin signaling and EMT-associated proteins, and observe cell proliferation, invasion and migration abilities in vitro and in vivo. Results: Clinical association studies showed that Prrx2 expression was related to tumor size, lymph node metastasis, tumor node metastasis stages, EMT and poor survival. Results also showed that knockdown of Prrx2 could alter cell morphology, suppressed the abilities of cell proliferation, invasion and migration in breast cancer. Moreover, silencing of Prrx2 induced the mesenchymal-epithelial transition and prevented nuclear translocation of β-catenin, inhibited wnt/β-catenin signaling pathway. Conclusion: Our study indicated that Prrx2 may be an important activator of EMT in human breast cancer and it can serve as a molecular target of therapeutic interventions for breast cancer.

show abstract

Section: Discussionmentioning

confidence: 99%

Silencing of Prrx2 Inhibits the Invasion and Metastasis of Breast Cancer both In Vitro and In Vivo by Reversing Epithelial-Mesenchymal Transition

Lv¹,

Wang

Liu

et al. 2017

Cell Physiol Biochem

View full text Add to dashboard Cite

show abstract

“…ND7/23 cell line was from the European Collection of Cell Cultures. This cell line was cultured and transfected as previously described ( Monteiro et al, 2014 ) with a Tlx3 expressing vector ( Regadas et al, 2013 ).…”

Section: Methodsmentioning

confidence: 99%

“…RNA extraction and real-time qPCR assays were performed essentially as previously described ( Monteiro et al, 2014 ), with the following modifications: (i) RNA was purified using total RNA isolation kit (NZYTech), including a step of DNase I treatment of the binding column, and cDNA was prepared using oligo dT primers and M-MuLV Reverse Transcriptase (NZYTech) according to the manufacturer’s instructions; (ii) real-time qPCR analysis was performed using the NZYSpeedy qPCR Green Master Mix (NZYTech) on a CFX384 qPCR System (Bio-Rad). The primer sequences were CCTGACAAAGAAGCGCCTTA and ACACGTTTGGGCAAAAGTACA for Tlx3 targeting the 3′UTR, and TTGCTGACCTGCTGGATTAC and GTCCTTTTCACCAGCAAGC for Hprt housekeeping gene.…”

Section: Methodsmentioning

confidence: 99%

Tlx3 Exerts Direct Control in Specifying Excitatory Over Inhibitory Neurons in the Dorsal Spinal Cord

Monteiro

Miranda

Samina

et al. 2021

Front. Cell Dev. Biol.

Self Cite

View full text Add to dashboard Cite

The spinal cord dorsal horn is a major station for integration and relay of somatosensory information and comprises both excitatory and inhibitory neuronal populations. The homeobox gene Tlx3 acts as a selector gene to control the development of late-born excitatory (dILB) neurons by specifying glutamatergic transmitter fate in dorsal spinal cord. However, since Tlx3 direct transcriptional targets remain largely unknown, it remains to be uncovered how Tlx3 functions to promote excitatory cell fate. Here we combined a genomics approach based on chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) and expression profiling, with validation experiments in Tlx3 null embryos, to characterize the transcriptional program of Tlx3 in mouse embryonic dorsal spinal cord. We found most dILB neuron specific genes previously identified to be directly activated by Tlx3. Surprisingly, we found Tlx3 also directly represses many genes associated with the alternative inhibitory dILA neuronal fate. In both cases, direct targets include transcription factors and terminal differentiation genes, showing that Tlx3 directly controls cell identity at distinct levels. Our findings provide a molecular frame for the master regulatory role of Tlx3 in developing glutamatergic dILB neurons. In addition, they suggest a novel function for Tlx3 as direct repressor of GABAergic dILA identity, pointing to how generation of the two alternative cell fates being tightly coupled.

show abstract

“…Upregulation upon UCE deletion can be explained by the fact that the proximal promoter of Prrxl1 mediates self-repression (Monteiro et al 2014), suggesting that the deletion likely removed binding sites required for Prrxl1 repression.…”

Section: Uce Knock-outs Have No Effect On Stem Cell Differentiationmentioning

confidence: 99%

Large-scale dissection suggests that ultraconserved elements are dispensable for mouse embryonic stem cell survival and fitness

Schneider

Hiller

Buchholz

2019

Preprint

View full text Add to dashboard Cite

Ultraconserved elements (UCEs) are genomic regions that are highly conserved among vertebrates and are under extreme purifying selection. Despite this extreme conservation, the biological importance of UCEs has remained elusive thus far. Here, we investigate the relevance of 93 UCEs for survival and fitness of mouse embryonic stem cells (mESCs) utilizing CRISPR/Cas9 technology. Surprisingly, systematic analyses of deletion clones revealed no measurable effects on mESC viability, proliferation or morphology.Furthermore, growth of homozygous UCE knockout clones under stress conditions or growth in direct competition with wild-type mESC revealed no phenotypic difference. Likewise, no difference in differentiation potential and on the expression level of key marker genes of differentiation was observed upon embryonic body formation. While functional overlap (redundancy) between several UCEs has been proposed to account for the absence of effects in single UCE knockouts, we obtained phenotypically normal mESC clones carrying up to five homozygous UCEs deletions, challenging this model. Finally, integration of additional UCE copies into the genome of mESCs also revealed no adverse effects. In summary, under all tested experimental conditions, UCEs appear to be dispensable for fitness, viability and differentiation potential of mESCs, despite their strong conservation.

show abstract

Paired related homeobox protein‐like 1 (Prrxl1) controls its own expression by a transcriptional autorepression mechanism

Cited by 10 publications

References 36 publications

Silencing of Prrx2 Inhibits the Invasion and Metastasis of Breast Cancer both In Vitro and In Vivo by Reversing Epithelial-Mesenchymal Transition

Silencing of Prrx2 Inhibits the Invasion and Metastasis of Breast Cancer both In Vitro and In Vivo by Reversing Epithelial-Mesenchymal Transition

Tlx3 Exerts Direct Control in Specifying Excitatory Over Inhibitory Neurons in the Dorsal Spinal Cord

Large-scale dissection suggests that ultraconserved elements are dispensable for mouse embryonic stem cell survival and fitness

Contact Info

Product

Resources

About