p53 Regulates Cellular Resistance to Complement Lysis through Enhanced Expression of CD59

Donev, Rossen; Cole, Duncan; Sivasankar, Baalasubramanian; Hughes, Timothy R.; Morgan, B. Paul

doi:10.1158/0008-5472.can-05-3191

Cited by 26 publications

(30 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, the finding of large variability at the cellular level in expression of CD59 is rather intriguing and needs to be elucidated. Apparently, p53 enhances expression of CD59 (48,49). Thus, one possibility is that variability in the level of activation of p53 results in a heterogeneous distribution of CD59 level of expression.…”

Section: Discussionmentioning

confidence: 96%

Live Cell Imaging of Outward and Inward Vesiculation Induced by the Complement C5b-9 Complex

Moskovich

Fishelson

2007

Journal of Biological Chemistry

View full text Add to dashboard Cite

Cells resist death induced by the complement membrane attack complex (MAC, C5b-9) by removal of the MAC from their surface by an outward and/or inward vesiculation. To gain an insight into the route of MAC removal, human C9 was tagged with Alexa Fluor 488 and traced within live cells. Tagged C9-AF488 was active in lysis of erythrocytes and K562 cells. Upon treatment of K562 cells with antibody and human serum containing C9-AF488, C9-AF488 containing MAC bound to the cells. Within 5-10 min, the cells started shedding C5b-9-loaded vesicles (0.05-1 m) by outward vesiculation. Concomitantly, C9-AF488 entered the cells and accumulated in a perinuclear, late recycling compartment, co-localized with endocytosed transferrin-Texas Red. Similar results were obtained with fixed cells in which the MAC was labeled with antibodies directed to a C5b-9 neoepitope. Inhibition of protein kinase C reduced endocytosis of C5b-9. Kinetic analysis demonstrated that peripheral, trypsin-sensitive C5b-9 was cleared from cells at a slower rate relative to fully inserted, trypsin-resistant C5b-9. MAC formation is controlled by CD59, a ubiquitously expressed membrane complement regulator. Analysis at a cell population level showed that the amount of C5b-9-AF488 bound to K562 cells after complement activation was highly heterogeneous and inversely correlated with the CD59 level of expression. Efficient C9-AF488 vesiculation was observed in cells expressing low CD59 levels, suggesting that the protective impact of MAC elimination by vesiculation increases as the level of expression of CD59 decreases.The complement system is a major component of the innate immune system. It efficiently protects the host from pathogenic microorganisms, is involved in immune complex regulation, and serves an important link between innate and adaptive immune responses. Complement comprises a group of more than 30 proteins; most of them participate in the cascade-like activation process, whereas others serve as control proteins or act as cellular receptors (1, 2). Initiation of the complement activation cascade may occur through the classical, alternative, or lectin pathways. The three initiation pathways lead to activation of the terminal complement pathway and to assembly of the membrane attack complexes (MACs) 2 that are composed of the complement components C5b, C6, C7, C8, and C9 (also known as the C5b-9 complexes). Upon formation of C5b-7, C5b-8, and finally C5b-9 complexes, they adhere and then insert into the target cell membrane (3). The C5b-9 complexes may contain 1-18 C9 molecules attached to a C5b-8 complex. When the number of C9 molecules per C5b-8 exceeds 12, they self-polymerize and form a cylinder-shaped transmembrane structure (4). Upon its assembly, the MAC expresses neoantigens that can be detected by specific monoclonal antibodies (5). Although red blood cells require only one effective MAC to lyse, nucleated cells are killed by complement only after a combined action of several MACs (6). Although larger C5b-9 channels containing several C9 a...

show abstract

Section: Discussionmentioning

confidence: 96%

Live Cell Imaging of Outward and Inward Vesiculation Induced by the Complement C5b-9 Complex

Moskovich

Fishelson

2007

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Total RNA was extracted from spinal cords and hippocampi and amplified with specific primer pairs (Table S3) as previously described (44). At least two independent experiments were performed in triplicate for each cDNA.…”

Section: Characterization Of Cns Changes See Si Materials and Methodmentioning

confidence: 99%

C3-dependent mechanism of microglial priming relevant to multiple sclerosis

Ramaglia¹,

Hughes²,

Donev³

et al. 2012

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

131

102

View full text Add to dashboard Cite

Microglial priming predisposes the brain to neurodegeneration and affects disease progression. The signal to switch from the quiescent to the primed state is unknown. We show that deleting the C3 convertase regulator complement receptor 1-related protein y (Crry) induces microglial priming. Mice that were double-knockout for Crry and either C3 or factor B did not show priming, demonstrating dependence on alternative pathway activation. Colocalization of C3b/ iC3b and CR3 implicated the CR3/iC3b interaction in priming. Systemic lipopolysaccharide challenge overactivated primed microglia with florid expression of proinflammatory molecules, which were blocked by complement inhibition. Relevance for neurodegenerative disease is exemplified by human multiple sclerosis (MS) and by experimental autoimmune encephalomyelitis (EAE), a model of MS. In human MS, microglial priming was evident in perilesional white matter, in close proximity to C3b/iC3b deposits. EAE was accelerated and exacerbated in Crry-deficient mice, and was dependent on C activation. In summary, C3-dependent microglial priming confers susceptibility to other challenges. Our observations are relevant to progression in MS and other neurological diseases exacerbated by acute insults.

show abstract

“…Analyses were carried out as previously described. 22 Design of peptide for overexpression of CD59 To test the effect of REST-derived peptide on the expression of CD59, a pDR2DEF1a-based construct for expression in mammalian cells was designed. The sense (5 0 -CTAGAGCCA CCATGATGCATCATCATCATCATCATGGTGGTGGTTATAAA TGTGAACTTTGTCCTTACTCAAGTTCTCAGAAGACTCATC TAACTAGACATATGCGTACTCATTGAG-3 0 ) and antisense (5 0 -GATCCTCAATGAGTACGCATATGTCTAGTTAGATGAGT CTTCTGAGAACTTGAGTAAGGACAAAGTTCACATTTATAAC CACCACCATGATGATGATGATGATGCATCATGGTGGCT-3 0 ) oligonucleotides were synthesized (Biomers.net GmbH, Ulm, Germany) and annealed, leaving the XbaI and Bam HI overhangs at their 5 0 and 3 0 ends, respectively, for ligation into an appropriately digested pDR2DEF1a vector.…”

Section: Dot-blot Analysesmentioning

confidence: 99%

“…The IMR32 cells transfected either with the REST5 or NLS expression construct were analysed as previously described, 22 using Magna ChIP A kit (Millipore). Immunoprecipitation was carried out with rabbit polyclonal anti-Sp1 (catalogue number 17-601, Millipore), rabbit polyclonal anti-AP2 (catalogue number ab52222, Abcam), sheep polyclonal anti-CPBP (catalogue number AF3499, R&D Systems Europe, Abingdon, UK) or polyclonal anti-REST (C-15) (catalogue number sc-15120, Santa Cruz Biotechnology).…”

Section: Chromatin Immunoprecipitation (Chip)mentioning

confidence: 99%

Upregulating CD59: a new strategy for protection of neurons from complement-mediated degeneration

et al. 2009

View full text Add to dashboard Cite

An increasing number of studies have shown a critical role for the membrane attack complex, synthesized on activation of the terminal pathway of the complement system, in causing demyelination and neuronal death in neurodegeneration. The aim of this study was to develop a strategy to increase the resistance of neurons to complement damage by modulating the expression of membrane complement regulatory protein CD59, the only inhibitor of the terminal pathway of the complement cascade. We exploited our recent finding that CD59 expression is regulated by the neural-restrictive silencer factor (REST) and designed a novel REST-derived peptide (REST5) containing the nuclear localization domain of the wild-type protein. The effect of REST5 and the mechanism by which it modulates CD59 expression were modelled in neuroblastoma cells transfected with expression constructs, and then confirmed in human neurons differentiated from neural progenitor cells. REST5 increased the expression of CD59 in neurons by fivefold and protected them from complement-mediated lysis spontaneously triggered by neurons. As a source of complement, we used either human serum or conditioned medium from primary human oligodendroglia. This study brings new insight into immunopharmacological research that may serve to inhibit neuronal death triggered by the terminal pathway of complement activation.

show abstract

p53 Regulates Cellular Resistance to Complement Lysis through Enhanced Expression of CD59

Cited by 26 publications

References 53 publications

Live Cell Imaging of Outward and Inward Vesiculation Induced by the Complement C5b-9 Complex

Live Cell Imaging of Outward and Inward Vesiculation Induced by the Complement C5b-9 Complex

C3-dependent mechanism of microglial priming relevant to multiple sclerosis

Upregulating CD59: a new strategy for protection of neurons from complement-mediated degeneration

Contact Info

Product

Resources

About