ox‐LDL increases microRNA‐29a transcription through upregulating YY1 and STAT1 in macrophages

Abstract

Macrophages and oxidized low-density lipoprotein (ox-LDL) have been verified playing vital roles in the pathogenesis of atherosclerosis (AS). Previous studies demonstrated that microRNA-29a (miR-29a) was upregulated in many atherogenic process and cells, thus acting as an important participant in AS. But the detailed regulation mechanism of miR-29a in AS has not been fully understood. In our study, we demonstrated a positive feedback loop of ox-LDL-SRA-miR-29a. Furthermore, we found that YY1 and STAT1 were upregulated in ox-LDL-stimulating macrophages followed by translocation in the nucleus and binding to the transcriptional promoter region of miR-29a, thus leading to the increase of miR-29a expression. In addition, we demonstrated that JAK1/2 signaling was involved in miR-29a upregulation. Finally, we found that miR-29a played important roles in the secretion of proinflammation factors and lipid uptake in macrophages. We uncovered the molecular mechanism and provide novel insights into the function and regulatory network of miR-29a expression regulated by ox-LDL in macrophages.

miRNA-29a inhibits atherosclerotic plaque formation by mediating macrophage autophagy via PI3K/AKT/mTOR pathway

“…Previous studies have indicated that the PI3K/AKT/mTOR signaling pathway plays a critical regulatory role in autophagy [ 11 ]. We investigated the specific effects of miR-29a on autophagy and PI3K/AKT/mTOR signaling pathway.…”

“…Recently, many studies have reported the inseparable relationship between miRNAs and AS, which are involved in the functional regulation of mononuclear macrophages [8][9][10]. In addition, Jian et al have confirmed that miR-29a could promote the secretion of pro-inflammation factors such as interleukin-1 (IL-1), IL-6, and TNF-α and affect the formation of atherosclerotic plaques by regulating the survival status of macrophages [11]. However, the underlying molecular mechanisms of miR-29a in AS are not fully clear.…”

YY1 affects the levels and function of fibulin‑5 in ox‑LDL‑treated vascular smooth muscle cells

“…For instance, YY1 initiated the activity of the X-inactive specific transcript (Xist) promoter by directly binding to the Xist 5' region in ES cells ( 24 ). Downstream, YY1 was also revealed to be involved in the pathophysiology of AS by regulating cell proliferation and apoptosis ( 12 , 26 , 27 ). For example, a previous study reported that YY1 was involved in the promoting effects of miR-544 on the maturation and antioxidative effects of stem cell-derived endothelial-like cells ( 28 ).…”

“…For example, a previous study reported that YY1 was involved in the promoting effects of miR-544 on the maturation and antioxidative effects of stem cell-derived endothelial-like cells ( 28 ). A previous mechanistic analysis of YY1 in ox-LDL-treated macrophages of AS demonstrated that YY1 can translocate into the nucleus and increase the expression of miR-29a by binding to its transcriptional promoter region ( 27 ).…”

Interferon‐induced protein 35 inhibits endothelial cell proliferation, migration and re‐endothelialization of injured arteries by inhibiting the nuclear factor‐kappa B pathway

“…Western blot and qPCR assay were performed as described previously . Oligo(dT) primers were used as follows: IFI35: 5′‐AACAAAAGGAGCACACGATCA‐3′ and 3‐′CTCCGTTCCTAGTCTTGCCAA‐5′; P65: 5′‐ATGTGGAGATCATTGAGCAGC‐3′ and 3′‐CCTGGTCCTGTGTAGCCATT‐5′; GAPDH: 5′‐TCAACGACCACTTTGTCAAGCTCA‐3′ and 3′‐GCTGGTGGTCCAGGGGTCTTACT‐5′.…”